Gene detail

Detail information of GWHGAAZE003995

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP06199.1	1.16448E-69	unnamed protein product [Coffea canephora]
COG	YP_003590363.1	1E-19	short-chain dehydrogenase/reductase SDR
Swissprot	tr\|Q5KTS5\|GRDH_DAUCA	1E-10	Glucose and ribitol dehydrogenase
trEMBL	tr\|A0A068UDF9\|A0A068UDF9_COFCA	4E-70	Coffea canephora DH200=94 genomic scaffold, scaffold_20 {ECO:0000313\|EMBL:CDP06199.1}
TAIR10	AT1G63380.1	1E-40	NAD(P)-binding Rossmann-fold superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	108749674	108753621	-
GWHAAZE00000001	mRNA	108749674	108753621	-
GWHAAZE00000001	exon	108749674	108749814	-
GWHAAZE00000001	exon	108750488	108750717	-
GWHAAZE00000001	exon	108753270	108753621	-
GWHAAZE00000001	five_prime_UTR	108753400	108753621	-
GWHAAZE00000001	CDS	108753270	108753399	-
GWHAAZE00000001	CDS	108750488	108750717	-
GWHAAZE00000001	CDS	108749674	108749814	-

Transcript Sequence
>GWHTAAZE004001 AAAAAATGGCTTGCCAAATCTTGAACCACCTTGAGCCATGGTCCGATTTGAGAGGCATGGTGGTGTTGGTGACCGGTGCATCCTCAGGGCTAGGCCGAGAGTTCTGTGTTGACCTAGCCAAGGCCGGTTGCAGGGTGGTTGCAGCCGCTCGTAGAACAGACCGCCTCAAATCTCTTTGCGATGAAATAAACCGATGTGACATTTCGAGATCGTTGATGGGTGATGACTCCTCTTGCCATTGCTGTGGAGCTTGATATTACTGGTGAAGCTAAAGCCATTAAGGATTCTGTTGATAGAGCTTGGGCTGCATTTGGGCATATTGATACTTTGGTCAATAATGCTAGCATTAGAGGGACAGTAAATAATTCATTGGATTTACCAGAAGAGGAGTGGGAAAATGTGATAAGAACAAATTTAACCGGGACATGGTTAGTATCCAAATATGTTGGTGCATACATGAGAAGTGCTGGTAAAGGTGGGTCCATCATCAATATTTCCTCTGTGTCTGGTCTCAATCGACCCCAATTCTGTGGAGGTGTTGGCTATAGTTCCTCTAAAGCGGCTATGGACTCTATGACCAAGACGTTCGGTACATCAGATCCAGCGTTGACATCGCTTGTTCGATACTTAATGCACAACTTATCAAAATATATTACAGGCAACATCTTCATTGTTGATGCTGGTTTTACCCTTCCCGGTTTTCCAATTTTCTCGGCACTTTGA

Network for GWHGAAZE003995

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0020

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00106.26	adh_short	5	122	2.90E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.213
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.518
	SRR3591709	Stem	0.424
	SRR3591710	White floral bud	4.211
	SRR3591711	White flower	5.733
	SRR3591712	Green floral bud	0.544
	SRR3591713	Yellow flower	2.288
SRP173429	SRR8316895	Juvenile bud stage	0.258
	SRR8316896	Juvenile bud stage	0.102
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.281
	SRR8316900	Third green stage	0.191
	SRR8316901	Third green stage	0.043
	SRR8316898	Complete white stage	0.022
	SRR8316899	Complete white stage	0.035
	SRR8316903	Complete white stage	0.071
	SRR8316902	Silver flowering stage	0.023
	SRR8316904	Silver flowering stage	0.058
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.018
	SRR8316908	Gold flowering stage	0.008
SRP132670	SRR6706286	Control	0.071
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.037
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.094
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.081
	CNS0095600	Silvery flower (diploied) 3	0.007
	CNS0095601	Golden flower (diploid) 1	0.016
	CNS0095602	Golden flower (diploid) 2	0.007
	CNS0095603	Golden flower (diploid) 3	0.071
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.090
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.088
	CNS0095611	Silvery flower (tetraploid) 2	0.053
	CNS0095612	Silvery flower (tetraploid) 3	0.060
	CNS0095613	Golden flower (tetraploid) 1	0.080
	CNS0095614	Golden flower (tetraploid) 2	0.034
	CNS0095615	Golden flower (tetraploid) 3	0.211
CRA001975	CRR073297	Stem 1	0.125
	CRR073298	Stem 2	0.219
	CRR073299	Stem 3	0.005
	CRR073300	Leaf 1	0.091
	CRR073301	Leaf 2	0.070
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.046
	CRR073305	Juvenile bud 3	0.006
	CRR073306	Third green 1	0.022
	CRR073307	Third green 2	0.031
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.038
	CRR073310	Second white 2	0.073
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.011
	CRR073313	Silver flowering 2	0.155
	CRR073314	Silver flowering 3	0.036
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000