Gene detail

Detail information of GWHGAAZE004179

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009782889.1	3.95327E-85	PREDICTED: zeatin O-glucosyltransferase-like [Nicotiana sylvestris]
Swissprot	tr\|Q9ZSK5\|ZOG_PHALU	4E-73	Zeatin O-glucosyltransferase
trEMBL	tr\|A0A068V026\|A0A068V026_COFCA	7E-83	Coffea canephora DH200=94 genomic scaffold, scaffold_80 {ECO:0000313\|EMBL:CDP14140.1}
TAIR10	AT2G15480.2	5E-14	UDP-glucosyl transferase 73B5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	112759240	112759950	-
GWHAAZE00000001	mRNA	112759240	112759950	-
GWHAAZE00000001	exon	112759240	112759950	-
GWHAAZE00000001	CDS	112759240	112759950	-

Transcript Sequence
>GWHTAAZE004185 ATGCCTGCATTCAATGCATCCACCCACCTCCGTGAGCCTGTGGGGGCACTGCTGCGCAACATGTCACTTGATGCGCGTAGAATTGTGGTTATCCACGACTTGATGATGGCCACAGTGGTCCAGGATGTGGCCACGATTCCCGGTGCAGAGTCCTACACTTTTGAAAGCATCTCCGTTTTTTGCGTTTATTGGTCTTTAGTTGAAATCATGGGGAAACCTTGTCCTATCGACGACGAAGTAAGAAAAGAAATTCCTTCAATTGAAGAATGCTTACCTGCAGAGTTCTTTGACTTCGCTAAAAAACAACATGAACATGGACATTTCAACTCCGGCAAACTCTACAACATGTGCAAATCAATCGAAGGAAAATACATCGATCTGCTAACGAAAGAAGATATTAAAGGCAAGACAATGGATTGGTTTATCGGGCCACTAAATCCCGTGGTAGTAAACCAGAACCAGAATAAAAAACGTCATTGTTGTTTAGATTGGCTCGATGAACAAGCCCCAAATTCAGTAATATTTGTTTCGTTTGGAACTACAACTACATTTACAGACGAGCAAATTAACGAAATTGCAGTTGGATTGGAGCAGAGTGCGCAAAAGTTCATTTGGGTATTGCGAGATGCGGATAAAGGAGATGTGTTTGATGAAAATGTTAGAATGGCAAATTTACCAAAAGGCTACGAAGAGTTGAAGGGAGAGGAATAG

Network for GWHGAAZE004179

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00201.19	UDPGT	154	222	1.30E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13495	CISZOG	Zeatin biosynthesis	map00908

Gene Ontology

GO term	Ontology	Name
GO:0016758	molecular_function	transferase activity, transferring hexosyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.422
	SRR3591706	second leaf	10.270
	SRR3591707	mature leaf	8.354
	SRR3591708	Shoot apex	5.658
	SRR3591709	Stem	0.668
	SRR3591710	White floral bud	6.790
	SRR3591711	White flower	6.531
	SRR3591712	Green floral bud	6.341
	SRR3591713	Yellow flower	4.994
SRP173429	SRR8316895	Juvenile bud stage	2.284
	SRR8316896	Juvenile bud stage	2.799
	SRR8316897	Juvenile bud stage	1.229
	SRR8316894	Third green stage	2.331
	SRR8316900	Third green stage	15.591
	SRR8316901	Third green stage	11.767
	SRR8316898	Complete white stage	15.925
	SRR8316899	Complete white stage	32.689
	SRR8316903	Complete white stage	21.755
	SRR8316902	Silver flowering stage	5.118
	SRR8316904	Silver flowering stage	10.270
	SRR8316905	Silver flowering stage	5.814
	SRR8316906	Gold flowering stage	8.930
	SRR8316907	Gold flowering stage	9.006
	SRR8316908	Gold flowering stage	11.509
SRP132670	SRR6706286	Control	7.757
	SRR6706287	Light intensity 50%	8.457
	SRR6706288	Light intensity 20%	8.230
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.204
	CNS0095593	Slightly white alabastrum(diploid) 2	3.730
	CNS0095594	Slightly white alabastrum(diploid) 3	4.426
	CNS0095595	Whole white alabastrum(diploid) 2	4.423
	CNS0095596	Whole white alabastrum(diploid) 3	3.597
	CNS0095597	Whole white alabastrum(diploid) 4	3.600
	CNS0095598	Silvery flower (diploied) 1	3.299
	CNS0095599	Silvery flower (diploied) 2	3.802
	CNS0095600	Silvery flower (diploied) 3	9.423
	CNS0095601	Golden flower (diploid) 1	3.854
	CNS0095602	Golden flower (diploid) 2	5.238
	CNS0095603	Golden flower (diploid) 3	4.260
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.210
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.771
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.725
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.718
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.564
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.565
	CNS0095610	Silvery flower (tetraploid) 1	5.568
	CNS0095611	Silvery flower (tetraploid) 2	5.185
	CNS0095612	Silvery flower (tetraploid) 3	18.822
	CNS0095613	Golden flower (tetraploid) 1	5.171
	CNS0095614	Golden flower (tetraploid) 2	7.677
	CNS0095615	Golden flower (tetraploid) 3	9.785
CRA001975	CRR073297	Stem 1	3.533
	CRR073298	Stem 2	4.297
	CRR073299	Stem 3	2.093
	CRR073300	Leaf 1	7.680
	CRR073301	Leaf 2	8.485
	CRR073302	Leaf 3	6.332
	CRR073303	Juvenile bud 1	11.290
	CRR073304	Juvenile bud 2	11.621
	CRR073305	Juvenile bud 3	9.151
	CRR073306	Third green 1	24.629
	CRR073307	Third green 2	21.047
	CRR073308	Third green 3	21.455
	CRR073309	Second white 1	57.396
	CRR073310	Second white 2	56.749
	CRR073311	Second white 3	66.148
	CRR073312	Silver flowering 1	41.531
	CRR073313	Silver flowering 2	33.896
	CRR073314	Silver flowering 3	30.351
	CRR073315	Gold flowering 1	2.541
	CRR073316	Gold flowering 2	2.585
	CRR073317	Gold flowering 3	2.929
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.062
	CRR073320	Tawny withering 3	0.147