Gene detail

Detail information of GWHGAAZE004254

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006353052.1	2.5981E-132	PREDICTED: photosystem I reaction center subunit III, chloroplastic-like [Solanum tuberosum]
Swissprot	tr\|P46486\|PSAF_FLATR	6E-118	Photosystem I reaction center subunit III, chloroplastic (Precursor)
trEMBL	tr\|M1BWE4\|M1BWE4_SOLTU	1E-132	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400054481}
TAIR10	AT1G31330.1	3E-74	photosystem I subunit F

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	114044800	114045909	+
GWHAAZE00000001	mRNA	114044800	114045909	+
GWHAAZE00000001	exon	114044800	114045173	+
GWHAAZE00000001	exon	114045600	114045909	+
GWHAAZE00000001	CDS	114044800	114045173	+
GWHAAZE00000001	CDS	114045600	114045909	+

Transcript Sequence
>GWHTAAZE004260 ATGTCTCTCACAATTCCCACAAATCTCTACAAACCCATCACAAAACCCAAAGTGGGTTCTCAATTTACATCAAAACCAAGGCTATCAACATCTATCATCTGCTGTGCCTCTACCAATGACTCCGAGGCGGCGCCCACGGTGACCCCGCTAAAGGCATTCTCTGCTGCGCTGGCGCTGTCTTCGATCCTGCTGTCGACGCCTGTGTTGCCAGCATCGGCAGATATCTCGGGGCTGACACCATGCAAGGAGTCGAAGCAATTTGCTAAAAGAGAGAAGCAGTCGCTTAAAAAGCTTGAGTCTTCGCTCAAGCTTTACGAGCCGGATAGCGCTCCTGCTCTTGCTATCAAGGCCACCATGGAGAAAACCAAGCGCAGGTTCGACAACTACGGAAAGCAGGGACTACTGTGTGGATCAGACGGGCTACCACACCTGATAGTGAGCGGGGACCAGAGACACTGGGGAGAGTTCATCACCCCGGGGATTCTGTTCCTTTACATCGCCGGTTGGATAGGGTGGGTAGGCCGGAGCTACCTCATCGCCATTAGAGACGACAAGAAGCCCACACAAAAGGAGATCATCATTGACGTTCCATTGGCTTCAAGGCTCCTTTTCAGAGGATTCATCTGGCCCGTTGCTGCCTACAGAGAGTACTTGAACGGCGACCTCATCGACCCCTCTGTTTAA

Network for GWHGAAZE004254

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02507.16	PSI_PsaF	61	225	2.40E-79

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02694	psaF	Metabolic pathways	map01100
K02694	psaF	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009522	cellular_component	photosystem I
GO:0009538	cellular_component	photosystem I reaction center

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1011.987
	SRR3591706	second leaf	5351.288
	SRR3591707	mature leaf	3457.910
	SRR3591708	Shoot apex	2078.550
	SRR3591709	Stem	655.528
	SRR3591710	White floral bud	154.424
	SRR3591711	White flower	138.974
	SRR3591712	Green floral bud	111.424
	SRR3591713	Yellow flower	34.637
SRP173429	SRR8316895	Juvenile bud stage	270.990
	SRR8316896	Juvenile bud stage	216.105
	SRR8316897	Juvenile bud stage	188.949
	SRR8316894	Third green stage	90.679
	SRR8316900	Third green stage	144.554
	SRR8316901	Third green stage	134.585
	SRR8316898	Complete white stage	39.745
	SRR8316899	Complete white stage	112.368
	SRR8316903	Complete white stage	85.973
	SRR8316902	Silver flowering stage	20.564
	SRR8316904	Silver flowering stage	33.648
	SRR8316905	Silver flowering stage	14.751
	SRR8316906	Gold flowering stage	22.332
	SRR8316907	Gold flowering stage	30.605
	SRR8316908	Gold flowering stage	40.981
SRP132670	SRR6706286	Control	221.962
	SRR6706287	Light intensity 50%	168.035
	SRR6706288	Light intensity 20%	153.704
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	374.048
	CNS0095593	Slightly white alabastrum(diploid) 2	264.857
	CNS0095594	Slightly white alabastrum(diploid) 3	257.203
	CNS0095595	Whole white alabastrum(diploid) 2	194.389
	CNS0095596	Whole white alabastrum(diploid) 3	162.315
	CNS0095597	Whole white alabastrum(diploid) 4	126.338
	CNS0095598	Silvery flower (diploied) 1	461.519
	CNS0095599	Silvery flower (diploied) 2	493.630
	CNS0095600	Silvery flower (diploied) 3	183.372
	CNS0095601	Golden flower (diploid) 1	421.875
	CNS0095602	Golden flower (diploid) 2	235.487
	CNS0095603	Golden flower (diploid) 3	240.291
	CNS0095604	Slightly white alabastrum(tetraploid) 1	317.940
	CNS0095605	Slightly white alabastrum(tetraploid) 2	367.553
	CNS0095606	Slightly white alabastrum(tetraploid) 3	506.019
	CNS0095607	Whole white alabastrum(tetraploid) 1	181.132
	CNS0095608	Whole white alabastrum(tetraploid) 2	148.561
	CNS0095609	Whole white alabastrum(tetraploid) 3	201.139
	CNS0095610	Silvery flower (tetraploid) 1	198.863
	CNS0095611	Silvery flower (tetraploid) 2	310.075
	CNS0095612	Silvery flower (tetraploid) 3	191.370
	CNS0095613	Golden flower (tetraploid) 1	69.110
	CNS0095614	Golden flower (tetraploid) 2	163.411
	CNS0095615	Golden flower (tetraploid) 3	78.001
CRA001975	CRR073297	Stem 1	332.517
	CRR073298	Stem 2	288.348
	CRR073299	Stem 3	518.334
	CRR073300	Leaf 1	91.959
	CRR073301	Leaf 2	133.826
	CRR073302	Leaf 3	114.910
	CRR073303	Juvenile bud 1	95.798
	CRR073304	Juvenile bud 2	71.796
	CRR073305	Juvenile bud 3	118.861
	CRR073306	Third green 1	44.840
	CRR073307	Third green 2	45.599
	CRR073308	Third green 3	55.463
	CRR073309	Second white 1	51.306
	CRR073310	Second white 2	28.289
	CRR073311	Second white 3	15.317
	CRR073312	Silver flowering 1	19.147
	CRR073313	Silver flowering 2	24.630
	CRR073314	Silver flowering 3	13.843
	CRR073315	Gold flowering 1	2768.882
	CRR073316	Gold flowering 2	2475.053
	CRR073317	Gold flowering 3	2497.662
	CRR073318	Tawny withering 1	290.634
	CRR073319	Tawny withering 2	266.513
	CRR073320	Tawny withering 3	290.942