Gene detail

Detail information of GWHGAAZE004266

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP40665.1	6.9134E-145	hypothetical protein JCGZ_24664 [Jatropha curcas]
Swissprot	tr\|Q94AU2\|SEC22_ARATH	3E-143	25.3 kDa vesicle transport protein
trEMBL	tr\|A0A067L845\|A0A067L845_JATCU	3E-145	Uncharacterized protein {ECO:0000313\|EMBL:KDP40665.1}
TAIR10	AT1G11890.1	3E-105	Synaptobrevin family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	114203269	114207654	-
GWHAAZE00000001	mRNA	114203269	114207654	-
GWHAAZE00000001	exon	114203269	114203352	-
GWHAAZE00000001	exon	114205250	114205326	-
GWHAAZE00000001	exon	114206574	114206720	-
GWHAAZE00000001	exon	114206830	114206990	-
GWHAAZE00000001	exon	114207470	114207654	-
GWHAAZE00000001	CDS	114207470	114207654	-
GWHAAZE00000001	CDS	114206830	114206990	-
GWHAAZE00000001	CDS	114206574	114206720	-
GWHAAZE00000001	CDS	114205250	114205326	-
GWHAAZE00000001	CDS	114203269	114203352	-

Transcript Sequence
>GWHTAAZE004272 ATGGTGAAATTGACACTGATAGCTCGCGTAACTGATGGTCTTCCATTAGCAGAAGGTCTGGACGATGGCCGTGATCACCAGGATGAATTGTACAAGCAGCAAGCTAAATCTATATTCAAGAATCTGTCAAAAGGCCAGAATGAGCCTTCAAGAATGTCAATAGAAACTGGTCCTTACATCTTTCACTATATCATTGAAGGGCATGTTTGTTATTTGACCTTGTGTGATCGGTCTTATCCAAAGAAACTAGCTTTCCAATACCTTGAAGAGCTCAAGAATGAATTTGAAAGAGTCAACGGAAGTCAAATTGAAACTGCAGCTAGGCCATATGCATTTGTAAAATTTGATACATTCATACAAAAGACCAAGAAATTGTATTTGGATAGCCGAACTCAAAGGAACATTGGGAAATTAAATGACGAACTCTATGAAGTCCAACAAATAATGACACGCAATGTTCAAGAAGTTCTTGGAGTTGGTGAAAAGTTAGATCAGGTCAGTGAGTTGTCAAGTCGTTTGACTTCCGAATCTCGCATCTATGCTGACAAGGCAAAAGATCTGAATCGACAGGCATTGATTCGGAAGTGGGCTCCAGTTGCCATTGTGCTTGGGGTGGTTTTTCTCCTATTTTGGGTGAAGAAGAAGCTATGGTGA

Network for GWHGAAZE004266

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13774.7	Longin	35	117	2.80E-25
PF00957.22	Synaptobrevin	132	212	2.70E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08517	SEC22	SNARE interactions in vesicular transport	map04130
K08517	SEC22	Phagosome	map04145

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.781
	SRR3591706	second leaf	19.971
	SRR3591707	mature leaf	18.933
	SRR3591708	Shoot apex	31.269
	SRR3591709	Stem	50.011
	SRR3591710	White floral bud	43.130
	SRR3591711	White flower	56.974
	SRR3591712	Green floral bud	41.299
	SRR3591713	Yellow flower	59.464
SRP173429	SRR8316895	Juvenile bud stage	34.385
	SRR8316896	Juvenile bud stage	49.584
	SRR8316897	Juvenile bud stage	41.946
	SRR8316894	Third green stage	15.402
	SRR8316900	Third green stage	43.544
	SRR8316901	Third green stage	46.254
	SRR8316898	Complete white stage	32.760
	SRR8316899	Complete white stage	62.354
	SRR8316903	Complete white stage	40.314
	SRR8316902	Silver flowering stage	30.900
	SRR8316904	Silver flowering stage	42.998
	SRR8316905	Silver flowering stage	17.601
	SRR8316906	Gold flowering stage	69.167
	SRR8316907	Gold flowering stage	66.173
	SRR8316908	Gold flowering stage	86.493
SRP132670	SRR6706286	Control	34.810
	SRR6706287	Light intensity 50%	34.239
	SRR6706288	Light intensity 20%	37.665
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	38.772
	CNS0095593	Slightly white alabastrum(diploid) 2	27.456
	CNS0095594	Slightly white alabastrum(diploid) 3	30.451
	CNS0095595	Whole white alabastrum(diploid) 2	36.805
	CNS0095596	Whole white alabastrum(diploid) 3	31.792
	CNS0095597	Whole white alabastrum(diploid) 4	28.762
	CNS0095598	Silvery flower (diploied) 1	30.928
	CNS0095599	Silvery flower (diploied) 2	34.927
	CNS0095600	Silvery flower (diploied) 3	43.310
	CNS0095601	Golden flower (diploid) 1	26.643
	CNS0095602	Golden flower (diploid) 2	40.769
	CNS0095603	Golden flower (diploid) 3	44.578
	CNS0095604	Slightly white alabastrum(tetraploid) 1	32.854
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.430
	CNS0095606	Slightly white alabastrum(tetraploid) 3	35.425
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.724
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.923
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.545
	CNS0095610	Silvery flower (tetraploid) 1	47.038
	CNS0095611	Silvery flower (tetraploid) 2	35.896
	CNS0095612	Silvery flower (tetraploid) 3	40.135
	CNS0095613	Golden flower (tetraploid) 1	35.718
	CNS0095614	Golden flower (tetraploid) 2	39.841
	CNS0095615	Golden flower (tetraploid) 3	48.235
CRA001975	CRR073297	Stem 1	24.514
	CRR073298	Stem 2	23.249
	CRR073299	Stem 3	18.346
	CRR073300	Leaf 1	28.106
	CRR073301	Leaf 2	26.531
	CRR073302	Leaf 3	22.943
	CRR073303	Juvenile bud 1	18.627
	CRR073304	Juvenile bud 2	18.139
	CRR073305	Juvenile bud 3	9.208
	CRR073306	Third green 1	13.100
	CRR073307	Third green 2	13.580
	CRR073308	Third green 3	12.059
	CRR073309	Second white 1	9.316
	CRR073310	Second white 2	20.466
	CRR073311	Second white 3	14.225
	CRR073312	Silver flowering 1	13.514
	CRR073313	Silver flowering 2	6.828
	CRR073314	Silver flowering 3	11.164
	CRR073315	Gold flowering 1	17.659
	CRR073316	Gold flowering 2	28.010
	CRR073317	Gold flowering 3	9.409
	CRR073318	Tawny withering 1	26.146
	CRR073319	Tawny withering 2	33.416
	CRR073320	Tawny withering 3	24.356