Gene detail

Detail information of GWHGAAZE004437

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KCW73834.1	6.31245E-44	hypothetical protein EUGRSUZ_E02434 [Eucalyptus grandis]
trEMBL	tr\|A0A059C6F3\|A0A059C6F3_EUCGR	2E-44	Uncharacterized protein {ECO:0000313\|EMBL:KCW73834.1}
TAIR10	AT2G34620.1	5E-34	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	116941791	116942690	-
GWHAAZE00000001	mRNA	116941791	116942690	-
GWHAAZE00000001	exon	116942386	116942690	-
GWHAAZE00000001	exon	116941791	116942030	-
GWHAAZE00000001	five_prime_UTR	116942667	116942690	-
GWHAAZE00000001	CDS	116942386	116942666	-
GWHAAZE00000001	CDS	116941925	116942030	-
GWHAAZE00000001	three_prime_UTR	116941791	116941924	-

Transcript Sequence
>GWHTAAZE004443 TTGATTCCAAAGCTTGAGTGTTTGATGGAATTTGGGTTTTCTAAAGAGGAGGCTATGGGGATGGTGTTGAGGTGCCCTGGTTTGTTTACTTTCAGTGTGGAGAATAATTTTAAGCCAAAGTTTAAGTATTTTGTTGAGGAGATGAAAGGTGAGTTGGAGGAGTTGAGGCAGTTTCCTCAGTATTTTGCTTTTAGTTTGGAGAAGAGGATAGTGCCTAGGCATATTGAGGCTGCGGAGGGTGGGGTGAAGGTCCCTTTGCCAGTTTTGCTTAAAAGCACTGATGAAGAGTATAGGGAGTTGATAAGGTGGAAGCTGATTGGAGTGGCAACGGTGTTGGCTAATGCAAGAACCTATCACAGTTGTGTACAAAGGAACAATAAATCAAAGGTGGATGTAGTGTCAAAAGTATAAATGACTTGTGCAATTACAATTATTTACCTTCTCTTGGCAACAAGCGCTGTAATAAGTCCCCTTATCTTTTACATTTGGTTTTCCAATATCCTACCTATGTAGCCATGTTTATCCTCGAACCAATTGGATATTCC

Network for GWHGAAZE004437

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	1	89	1.30E-23

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.088
	SRR3591706	second leaf	56.862
	SRR3591707	mature leaf	37.189
	SRR3591708	Shoot apex	36.382
	SRR3591709	Stem	11.913
	SRR3591710	White floral bud	2.497
	SRR3591711	White flower	3.243
	SRR3591712	Green floral bud	0.917
	SRR3591713	Yellow flower	0.551
SRP173429	SRR8316895	Juvenile bud stage	5.554
	SRR8316896	Juvenile bud stage	5.569
	SRR8316897	Juvenile bud stage	1.241
	SRR8316894	Third green stage	1.780
	SRR8316900	Third green stage	1.297
	SRR8316901	Third green stage	1.433
	SRR8316898	Complete white stage	0.640
	SRR8316899	Complete white stage	2.553
	SRR8316903	Complete white stage	1.937
	SRR8316902	Silver flowering stage	0.296
	SRR8316904	Silver flowering stage	0.187
	SRR8316905	Silver flowering stage	0.098
	SRR8316906	Gold flowering stage	0.292
	SRR8316907	Gold flowering stage	0.444
	SRR8316908	Gold flowering stage	0.640
SRP132670	SRR6706286	Control	1.301
	SRR6706287	Light intensity 50%	0.593
	SRR6706288	Light intensity 20%	0.382
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.111
	CNS0095593	Slightly white alabastrum(diploid) 2	5.933
	CNS0095594	Slightly white alabastrum(diploid) 3	3.978
	CNS0095595	Whole white alabastrum(diploid) 2	3.405
	CNS0095596	Whole white alabastrum(diploid) 3	2.980
	CNS0095597	Whole white alabastrum(diploid) 4	0.851
	CNS0095598	Silvery flower (diploied) 1	9.978
	CNS0095599	Silvery flower (diploied) 2	9.082
	CNS0095600	Silvery flower (diploied) 3	1.440
	CNS0095601	Golden flower (diploid) 1	21.397
	CNS0095602	Golden flower (diploid) 2	7.044
	CNS0095603	Golden flower (diploid) 3	7.575
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.124
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.043
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.928
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.585
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.003
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.120
	CNS0095610	Silvery flower (tetraploid) 1	0.850
	CNS0095611	Silvery flower (tetraploid) 2	2.212
	CNS0095612	Silvery flower (tetraploid) 3	0.395
	CNS0095613	Golden flower (tetraploid) 1	0.442
	CNS0095614	Golden flower (tetraploid) 2	1.602
	CNS0095615	Golden flower (tetraploid) 3	0.567
CRA001975	CRR073297	Stem 1	7.098
	CRR073298	Stem 2	8.981
	CRR073299	Stem 3	9.538
	CRR073300	Leaf 1	1.826
	CRR073301	Leaf 2	1.056
	CRR073302	Leaf 3	1.227
	CRR073303	Juvenile bud 1	0.221
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.975
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.297
	CRR073308	Third green 3	0.136
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.015
	CRR073314	Silver flowering 3	0.858
	CRR073315	Gold flowering 1	24.630
	CRR073316	Gold flowering 2	20.696
	CRR073317	Gold flowering 3	29.125
	CRR073318	Tawny withering 1	8.357
	CRR073319	Tawny withering 2	4.947
	CRR073320	Tawny withering 3	5.895