Gene detail

Detail information of GWHGAAZE004518

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010243693.1	1.61525E-51	PREDICTED: uncharacterized protein LOC104587686 isoform X3 [Nelumbo nucifera]
COG	YP_007202898.1	3E-21	pterin-4a-carbinolamine dehydratase
trEMBL	tr\|D7TK00\|D7TK00_VITVI	2E-49	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI30822.3}
TAIR10	AT1G29810.1	3E-31	Transcriptional coactivator/pterin dehydratase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	118298923	118299532	+
GWHAAZE00000001	mRNA	118298923	118299532	+
GWHAAZE00000001	exon	118298923	118299060	+
GWHAAZE00000001	exon	118299142	118299265	+
GWHAAZE00000001	exon	118299456	118299532	+
GWHAAZE00000001	CDS	118298923	118299060	+
GWHAAZE00000001	CDS	118299142	118299265	+
GWHAAZE00000001	CDS	118299456	118299532	+

Transcript Sequence
>GWHTAAZE004524 ATGGCTTGGGTTCATGTAAATGGTCCGGTAGTACTACTGCTTTTCATGCCAGATTTGTCGATCAAGAAGTGTGTGCCATGCAACTCAAAGGATTTGGGGCCCATGACTGAAGAAGCCGTAAATTTACTAATTAAACAGGTACCTGAATGGAATTTGGTGAATGAAGGTGGTATGATGAAGCTGCATCGGTCATGGAAAGTCAAGAGTTTCACCAAGGGATTGGAGTTCTTTGAAGCTGTAGCCAGTGTTGCTGAAGCTGAAGGTCACCATCCTGATCTTCATCTCGTTGGATGGAACAATGTGAAAATTGACATATGGACGCATGCTGTAGGTAAGTAA

Network for GWHGAAZE004518

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01329.20	Pterin_4a	34	111	8.80E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01724	PCBD, phhB	Metabolic pathways	map01100
K01724	PCBD, phhB	Folate biosynthesis	map00790

Gene Ontology

GO term	Ontology	Name
GO:0006729	biological_process	tetrahydrobiopterin biosynthetic process
GO:0008124	molecular_function	4-alpha-hydroxytetrahydrobiopterin dehydratase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	29.837
	SRR3591706	second leaf	27.541
	SRR3591707	mature leaf	51.512
	SRR3591708	Shoot apex	38.361
	SRR3591709	Stem	35.404
	SRR3591710	White floral bud	27.108
	SRR3591711	White flower	21.416
	SRR3591712	Green floral bud	37.507
	SRR3591713	Yellow flower	25.771
SRP173429	SRR8316895	Juvenile bud stage	29.090
	SRR8316896	Juvenile bud stage	46.074
	SRR8316897	Juvenile bud stage	27.281
	SRR8316894	Third green stage	18.341
	SRR8316900	Third green stage	50.948
	SRR8316901	Third green stage	43.380
	SRR8316898	Complete white stage	12.669
	SRR8316899	Complete white stage	59.880
	SRR8316903	Complete white stage	27.134
	SRR8316902	Silver flowering stage	13.799
	SRR8316904	Silver flowering stage	17.256
	SRR8316905	Silver flowering stage	7.592
	SRR8316906	Gold flowering stage	27.904
	SRR8316907	Gold flowering stage	27.484
	SRR8316908	Gold flowering stage	30.493
SRP132670	SRR6706286	Control	31.252
	SRR6706287	Light intensity 50%	37.874
	SRR6706288	Light intensity 20%	39.152
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	66.949
	CNS0095593	Slightly white alabastrum(diploid) 2	65.933
	CNS0095594	Slightly white alabastrum(diploid) 3	59.749
	CNS0095595	Whole white alabastrum(diploid) 2	49.458
	CNS0095596	Whole white alabastrum(diploid) 3	50.383
	CNS0095597	Whole white alabastrum(diploid) 4	53.092
	CNS0095598	Silvery flower (diploied) 1	52.616
	CNS0095599	Silvery flower (diploied) 2	45.889
	CNS0095600	Silvery flower (diploied) 3	32.613
	CNS0095601	Golden flower (diploid) 1	39.298
	CNS0095602	Golden flower (diploid) 2	28.126
	CNS0095603	Golden flower (diploid) 3	26.524
	CNS0095604	Slightly white alabastrum(tetraploid) 1	64.443
	CNS0095605	Slightly white alabastrum(tetraploid) 2	57.127
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.796
	CNS0095607	Whole white alabastrum(tetraploid) 1	52.250
	CNS0095608	Whole white alabastrum(tetraploid) 2	35.331
	CNS0095609	Whole white alabastrum(tetraploid) 3	41.049
	CNS0095610	Silvery flower (tetraploid) 1	53.734
	CNS0095611	Silvery flower (tetraploid) 2	38.262
	CNS0095612	Silvery flower (tetraploid) 3	37.236
	CNS0095613	Golden flower (tetraploid) 1	42.726
	CNS0095614	Golden flower (tetraploid) 2	42.244
	CNS0095615	Golden flower (tetraploid) 3	27.828
CRA001975	CRR073297	Stem 1	36.138
	CRR073298	Stem 2	31.311
	CRR073299	Stem 3	25.250
	CRR073300	Leaf 1	35.085
	CRR073301	Leaf 2	36.748
	CRR073302	Leaf 3	22.949
	CRR073303	Juvenile bud 1	32.672
	CRR073304	Juvenile bud 2	19.413
	CRR073305	Juvenile bud 3	23.452
	CRR073306	Third green 1	10.244
	CRR073307	Third green 2	9.270
	CRR073308	Third green 3	6.544
	CRR073309	Second white 1	8.079
	CRR073310	Second white 2	12.814
	CRR073311	Second white 3	7.487
	CRR073312	Silver flowering 1	4.872
	CRR073313	Silver flowering 2	6.930
	CRR073314	Silver flowering 3	3.335
	CRR073315	Gold flowering 1	24.400
	CRR073316	Gold flowering 2	29.522
	CRR073317	Gold flowering 3	20.876
	CRR073318	Tawny withering 1	21.320
	CRR073319	Tawny withering 2	25.452
	CRR073320	Tawny withering 3	25.618