Gene detail

Detail information of GWHGAAZE004584

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002266522.2	1.06779E-45	PREDICTED: dof zinc finger protein DOF1.5 [Vitis vinifera]
Swissprot	tr\|P68350\|DOF15_ARATH	2E-41	Dof zinc finger protein DOF1.5
trEMBL	tr\|F6HM95\|F6HM95_VITVI	4E-46	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB55683.1}
TAIR10	AT1G29160.1	2E-33	Dof-type zinc finger DNA-binding family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	119281909	119282220	+
GWHAAZE00000001	mRNA	119281909	119282220	+
GWHAAZE00000001	exon	119281909	119282220	+
GWHAAZE00000001	CDS	119281909	119282220	+

Transcript Sequence
>GWHTAAZE004590 ATGGAGACCAAATTTTGTTACTTCAATAATTATAATGTTAACCAACCTCGGCACTTTTGTAAGGGTTGTCAAAGGTACTGGACCGCCGGTGGGGCCCTACGGAATGTTCCGGTTGGGGCCGGTCGCCGGAAAGCTAAGCCGCCGGGCCGGGGCCTCGACGGGTTCCCTGAGAGTTGCTTGTTTGATGGATCGGACGGGTTTGGGTTTGATGAGGTGGTGGTGGAAGAGTGGCACGTGGCGACGCGAGGAGATTTAAGTCGAGGTTTTCCGGCGAAGAGGTTGAGGGGTACGGCGAGTGGTCAGAGTTGTTGA

Network for GWHGAAZE004584

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	1	46	3.00E-26

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.004
	SRR3591706	second leaf	0.234
	SRR3591707	mature leaf	0.651
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	3.419
	SRR3591710	White floral bud	3.107
	SRR3591711	White flower	6.115
	SRR3591712	Green floral bud	13.137
	SRR3591713	Yellow flower	4.985
SRP173429	SRR8316895	Juvenile bud stage	1.577
	SRR8316896	Juvenile bud stage	4.263
	SRR8316897	Juvenile bud stage	0.956
	SRR8316894	Third green stage	1.481
	SRR8316900	Third green stage	15.033
	SRR8316901	Third green stage	10.561
	SRR8316898	Complete white stage	1.804
	SRR8316899	Complete white stage	1.090
	SRR8316903	Complete white stage	2.995
	SRR8316902	Silver flowering stage	2.589
	SRR8316904	Silver flowering stage	2.654
	SRR8316905	Silver flowering stage	3.008
	SRR8316906	Gold flowering stage	7.883
	SRR8316907	Gold flowering stage	7.893
	SRR8316908	Gold flowering stage	6.860
SRP132670	SRR6706286	Control	6.571
	SRR6706287	Light intensity 50%	4.743
	SRR6706288	Light intensity 20%	5.045
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.502
	CNS0095593	Slightly white alabastrum(diploid) 2	9.677
	CNS0095594	Slightly white alabastrum(diploid) 3	14.435
	CNS0095595	Whole white alabastrum(diploid) 2	19.290
	CNS0095596	Whole white alabastrum(diploid) 3	21.887
	CNS0095597	Whole white alabastrum(diploid) 4	38.157
	CNS0095598	Silvery flower (diploied) 1	1.484
	CNS0095599	Silvery flower (diploied) 2	0.801
	CNS0095600	Silvery flower (diploied) 3	1.767
	CNS0095601	Golden flower (diploid) 1	0.817
	CNS0095602	Golden flower (diploid) 2	3.020
	CNS0095603	Golden flower (diploid) 3	2.669
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.499
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.159
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.575
	CNS0095607	Whole white alabastrum(tetraploid) 1	30.735
	CNS0095608	Whole white alabastrum(tetraploid) 2	30.114
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.399
	CNS0095610	Silvery flower (tetraploid) 1	6.164
	CNS0095611	Silvery flower (tetraploid) 2	1.574
	CNS0095612	Silvery flower (tetraploid) 3	3.501
	CNS0095613	Golden flower (tetraploid) 1	11.562
	CNS0095614	Golden flower (tetraploid) 2	6.296
	CNS0095615	Golden flower (tetraploid) 3	3.081
CRA001975	CRR073297	Stem 1	3.169
	CRR073298	Stem 2	3.184
	CRR073299	Stem 3	5.368
	CRR073300	Leaf 1	8.965
	CRR073301	Leaf 2	7.639
	CRR073302	Leaf 3	4.427
	CRR073303	Juvenile bud 1	4.684
	CRR073304	Juvenile bud 2	4.142
	CRR073305	Juvenile bud 3	3.749
	CRR073306	Third green 1	1.975
	CRR073307	Third green 2	8.326
	CRR073308	Third green 3	1.894
	CRR073309	Second white 1	4.362
	CRR073310	Second white 2	3.487
	CRR073311	Second white 3	1.925
	CRR073312	Silver flowering 1	8.676
	CRR073313	Silver flowering 2	10.338
	CRR073314	Silver flowering 3	10.294
	CRR073315	Gold flowering 1	0.747
	CRR073316	Gold flowering 2	1.235
	CRR073317	Gold flowering 3	0.131
	CRR073318	Tawny withering 1	11.217
	CRR073319	Tawny withering 2	9.747
	CRR073320	Tawny withering 3	4.633