Gene detail

Detail information of GWHGAAZE004633

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP45986.1	1.34965E-47	hypothetical protein JCGZ_11889 [Jatropha curcas]
Swissprot	tr\|O23553\|BAM3_ARATH	1E-47	Beta-amylase 3, chloroplastic (Precursor)
trEMBL	tr\|A0A067LBX2\|A0A067LBX2_JATCU	5E-48	Uncharacterized protein {ECO:0000313\|EMBL:KDP45986.1}
TAIR10	AT4G17090.1	3E-41	chloroplast beta-amylase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	119996679	119997654	+
GWHAAZE00000001	mRNA	119996679	119997654	+
GWHAAZE00000001	exon	119996679	119996820	+
GWHAAZE00000001	exon	119997023	119997206	+
GWHAAZE00000001	exon	119997474	119997654	+
GWHAAZE00000001	CDS	119996679	119996820	+
GWHAAZE00000001	CDS	119997023	119997206	+
GWHAAZE00000001	CDS	119997474	119997654	+

Transcript Sequence
>GWHTAAZE004639 GACTATCCCTCCCCAAATCGCCGGCCCCCCTCTCCGACGGTTCTGCTGTTCTCGCTTTCTCCTTCCGACGGTTCTGCTGCTCTTGCTCTCTCCCTAACGCACACTTTCTCTGGTACATATAACAGCAAAATCTCCTCCCCCAGCAGAATTTTAAATGAGCTGAACTGTAGTTCACCAGTGTGGGGGTTGGTAGAGAAAGAAGGGCCTTTGAAGTATAATTGGGAGAGATATGCAGAACTTGTGAAAATGGTTGAAAAACATGGAATGAAAATCCAAGTTGTCATGTCTTTTCACCAGTGTGGAGGAAATGTTGGAGACTCTTGCAGAGAAAGTGACCAGATTGAAAATTATAATGAACCTTTTGGTCTTAATTTTGGCATCCCTCTACCCCCATGGGCACTAGAAGAAATCAGCAAGAACCCTGATATGTTCTACACAGATAGATCAGGGCAGAGGAACCCCGAGTACATTTCCTTAGGATGTGACTCGTTACCCGTACTTAAATGA

Network for GWHGAAZE004633

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01373.18	Glyco_hydro_14	61	165	7.70E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01177	E3.2.1.2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0000272	biological_process	polysaccharide catabolic process
GO:0016161	molecular_function	beta-amylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	5.756
	SRR3591711	White flower	4.686
	SRR3591712	Green floral bud	4.541
	SRR3591713	Yellow flower	5.183
SRP173429	SRR8316895	Juvenile bud stage	12.534
	SRR8316896	Juvenile bud stage	15.421
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	4.645
	SRR8316900	Third green stage	12.020
	SRR8316901	Third green stage	10.598
	SRR8316898	Complete white stage	6.911
	SRR8316899	Complete white stage	25.836
	SRR8316903	Complete white stage	11.998
	SRR8316902	Silver flowering stage	5.774
	SRR8316904	Silver flowering stage	8.239
	SRR8316905	Silver flowering stage	3.982
	SRR8316906	Gold flowering stage	9.399
	SRR8316907	Gold flowering stage	10.936
	SRR8316908	Gold flowering stage	3.432
SRP132670	SRR6706286	Control	14.747
	SRR6706287	Light intensity 50%	14.806
	SRR6706288	Light intensity 20%	14.234
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.882
	CNS0095593	Slightly white alabastrum(diploid) 2	12.938
	CNS0095594	Slightly white alabastrum(diploid) 3	13.589
	CNS0095595	Whole white alabastrum(diploid) 2	9.064
	CNS0095596	Whole white alabastrum(diploid) 3	4.419
	CNS0095597	Whole white alabastrum(diploid) 4	7.568
	CNS0095598	Silvery flower (diploied) 1	21.170
	CNS0095599	Silvery flower (diploied) 2	10.548
	CNS0095600	Silvery flower (diploied) 3	15.586
	CNS0095601	Golden flower (diploid) 1	19.443
	CNS0095602	Golden flower (diploid) 2	15.816
	CNS0095603	Golden flower (diploid) 3	12.767
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.014
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.009
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.022
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.008
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.094
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.133
	CNS0095615	Golden flower (tetraploid) 3	0.004
CRA001975	CRR073297	Stem 1	15.613
	CRR073298	Stem 2	13.795
	CRR073299	Stem 3	7.872
	CRR073300	Leaf 1	10.479
	CRR073301	Leaf 2	16.626
	CRR073302	Leaf 3	8.093
	CRR073303	Juvenile bud 1	5.586
	CRR073304	Juvenile bud 2	3.950
	CRR073305	Juvenile bud 3	8.266
	CRR073306	Third green 1	3.463
	CRR073307	Third green 2	3.870
	CRR073308	Third green 3	5.262
	CRR073309	Second white 1	2.706
	CRR073310	Second white 2	2.722
	CRR073311	Second white 3	1.981
	CRR073312	Silver flowering 1	2.271
	CRR073313	Silver flowering 2	2.467
	CRR073314	Silver flowering 3	4.135
	CRR073315	Gold flowering 1	9.529
	CRR073316	Gold flowering 2	10.824
	CRR073317	Gold flowering 3	6.011
	CRR073318	Tawny withering 1	9.700
	CRR073319	Tawny withering 2	8.000
	CRR073320	Tawny withering 3	11.009