Gene detail

Detail information of GWHGAAZE004639

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHF27222.1	2.4028E-130	NAC transcription factor [Hevea brasiliensis]
Swissprot	tr\|Q6NQK2\|NAC8_ARATH	9E-68	NAC domain-containing protein 8
trEMBL	tr\|A0A059SWK2\|A0A059SWK2_HEVBR	9E-131	NAC transcription factor {ECO:0000313\|EMBL:AHF27222.1}
TAIR10	AT4G28500.1	3E-82	NAC domain containing protein 73

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	120086062	120087982	-
GWHAAZE00000001	mRNA	120086062	120087982	-
GWHAAZE00000001	exon	120087970	120087982	-
GWHAAZE00000001	exon	120087818	120087897	-
GWHAAZE00000001	exon	120087501	120087696	-
GWHAAZE00000001	exon	120086062	120086429	-
GWHAAZE00000001	CDS	120087970	120087982	-
GWHAAZE00000001	CDS	120087818	120087897	-
GWHAAZE00000001	CDS	120087501	120087696	-
GWHAAZE00000001	CDS	120086062	120086429	-

Transcript Sequence
>GWHTAAZE004645 ATGAAATGGTCCGTTATCGAGTCGAAAATTGATGAGATTCGGACCATAACATGCCCTTCGTGTGGCCATAACATACAACTACAAGATGATCAGGGTGGAGAAGGAGTGAATGATTTGCCAGGGCTTCCAGCAGGAGTGAAATTTGATCCATCAGACCAAGAAATACTTGAACATTTAGAGGCCAAGGTGCTTTATGATACCCACAAGCTTCATCCTCTAATTGACCAATTTATCCCTACCCTTGAAGGTGAAAATGGAATTTGTTATACTCACCCTGAGAAATTACCAGGAGTAAGCAAAGATGGACAAATCCGTCACTTCTTTCATCGGCCTTCAAAGGCATACACAACCGGAACAAGAAAACGAAGAAAGGTACACACGGACGATGATGACGGTGGAGAAACAAGGTGGCATAAAACCGGAAAAACTAGGCCAATTATAATCGGGGGCACCATAAGAGGTTACAAAAAAATACTAGTGCTTTACACAAATTATGGGAGGCAGAGAAAACCAGAGAAGACTAGTTGGGTAATGCACCAATATCATCTTGGTGACAATGAAGATGAAAAAGATGGAGAATTAGTGATCTCAAAAGTATTCTACCAAACACAGCCTAGAAATTGCAGTTCAAGTATTAAAGACTCAATTGATAACAAG

Network for GWHGAAZE004639

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	43	183	1.30E-21

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.323
	SRR3591706	second leaf	6.527
	SRR3591707	mature leaf	0.248
	SRR3591708	Shoot apex	3.914
	SRR3591709	Stem	69.733
	SRR3591710	White floral bud	9.752
	SRR3591711	White flower	4.448
	SRR3591712	Green floral bud	18.693
	SRR3591713	Yellow flower	4.564
SRP173429	SRR8316895	Juvenile bud stage	23.097
	SRR8316896	Juvenile bud stage	17.559
	SRR8316897	Juvenile bud stage	6.052
	SRR8316894	Third green stage	5.024
	SRR8316900	Third green stage	10.304
	SRR8316901	Third green stage	13.111
	SRR8316898	Complete white stage	0.565
	SRR8316899	Complete white stage	0.616
	SRR8316903	Complete white stage	0.418
	SRR8316902	Silver flowering stage	0.216
	SRR8316904	Silver flowering stage	0.139
	SRR8316905	Silver flowering stage	0.194
	SRR8316906	Gold flowering stage	0.663
	SRR8316907	Gold flowering stage	1.380
	SRR8316908	Gold flowering stage	1.129
SRP132670	SRR6706286	Control	11.041
	SRR6706287	Light intensity 50%	11.885
	SRR6706288	Light intensity 20%	10.045
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.748
	CNS0095593	Slightly white alabastrum(diploid) 2	3.214
	CNS0095594	Slightly white alabastrum(diploid) 3	6.676
	CNS0095595	Whole white alabastrum(diploid) 2	2.896
	CNS0095596	Whole white alabastrum(diploid) 3	3.808
	CNS0095597	Whole white alabastrum(diploid) 4	4.085
	CNS0095598	Silvery flower (diploied) 1	0.317
	CNS0095599	Silvery flower (diploied) 2	0.276
	CNS0095600	Silvery flower (diploied) 3	0.780
	CNS0095601	Golden flower (diploid) 1	0.450
	CNS0095602	Golden flower (diploid) 2	1.650
	CNS0095603	Golden flower (diploid) 3	1.320
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.224
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.359
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.793
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.207
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.460
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.282
	CNS0095610	Silvery flower (tetraploid) 1	0.755
	CNS0095611	Silvery flower (tetraploid) 2	0.724
	CNS0095612	Silvery flower (tetraploid) 3	0.674
	CNS0095613	Golden flower (tetraploid) 1	1.900
	CNS0095614	Golden flower (tetraploid) 2	2.212
	CNS0095615	Golden flower (tetraploid) 3	1.047
CRA001975	CRR073297	Stem 1	35.651
	CRR073298	Stem 2	19.941
	CRR073299	Stem 3	8.305
	CRR073300	Leaf 1	2.464
	CRR073301	Leaf 2	2.733
	CRR073302	Leaf 3	2.134
	CRR073303	Juvenile bud 1	0.130
	CRR073304	Juvenile bud 2	1.055
	CRR073305	Juvenile bud 3	0.433
	CRR073306	Third green 1	0.211
	CRR073307	Third green 2	0.205
	CRR073308	Third green 3	0.060
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.927
	CRR073311	Second white 3	0.044
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	1.204
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.075
	CRR073316	Gold flowering 2	0.479
	CRR073317	Gold flowering 3	0.412
	CRR073318	Tawny withering 1	5.358
	CRR073319	Tawny withering 2	6.987
	CRR073320	Tawny withering 3	8.417