Gene detail

Detail information of GWHGAAZE004772

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP19906.1	1.8605E-54	unnamed protein product [Coffea canephora]
Swissprot	tr\|B9RXW0\|TPS7_RICCO	2E-48	Alpha-farnesene synthase
trEMBL	tr\|A0A068VGQ7\|A0A068VGQ7_COFCA	7E-55	Coffea canephora DH200=94 genomic scaffold, scaffold_774 {ECO:0000313\|EMBL:CDP19906.1}
TAIR10	AT3G25810.1	6E-28	Terpenoid cyclases/Protein prenyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	122094998	122095819	+
GWHAAZE00000001	mRNA	122094998	122095819	+
GWHAAZE00000001	exon	122094998	122095144	+
GWHAAZE00000001	exon	122095523	122095819	+
GWHAAZE00000001	CDS	122094998	122095144	+
GWHAAZE00000001	CDS	122095523	122095819	+

Transcript Sequence
>GWHTAAZE004778 ATGCTCTTAATTTCTTCTCAGTGGGCAGATTTTTGCAAAGCATTGCTCGTGGAAGCGCAATGGTACAACAAGGGATACACACCTTCAATTCAAGATTATCTAGATAATGGGTGGATATCCCCATCTGGTCCAGTTCTCAATCTTCACGCGGAACTAGAAAGAGGGGATGCCCCTTCGTCAATCCTGTGTTTTATGAGGGAAGCAAACGTATCAGAGGAGATAGCTCGAAAGCACATTAGAAGCATAATAAGCAATACATGGAAGAAAATTAACAAAGAGTGCATTATTCAATCTCCGTTATTGAAGCCATTTGTTAAGTGTACAACAAACACAGCTCGCGTGGCGCATTTCATTTACCAAAATGGAGACGGGTTTGGTGTTCAAGACTGTGAGACTCGAGATCAGATCTTGTCTCTGTTGGTTGAACCTCTTGTACTCGACTAA

Network for GWHGAAZE004772

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03936.17	Terpene_synth_C	4	50	2.70E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14173	AFS1	Biosynthesis of secondary metabolites	map01110
K14173	AFS1	Sesquiterpenoid and triterpenoid biosynthesis	map00909

Gene Ontology

GO term	Ontology	Name
GO:0000287	molecular_function	magnesium ion binding
GO:0010333	molecular_function	terpene synthase activity
GO:0016829	molecular_function	lyase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.796
	SRR3591706	second leaf	5.096
	SRR3591707	mature leaf	5.033
	SRR3591708	Shoot apex	4.675
	SRR3591709	Stem	3.216
	SRR3591710	White floral bud	0.787
	SRR3591711	White flower	0.405
	SRR3591712	Green floral bud	0.279
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.299
	SRR8316896	Juvenile bud stage	0.789
	SRR8316897	Juvenile bud stage	0.133
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.169
	SRR8316901	Third green stage	0.080
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.172
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.142
	SRR8316906	Gold flowering stage	0.067
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.154
	SRR6706287	Light intensity 50%	0.051
	SRR6706288	Light intensity 20%	0.099
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.290
	CNS0095593	Slightly white alabastrum(diploid) 2	0.704
	CNS0095594	Slightly white alabastrum(diploid) 3	0.747
	CNS0095595	Whole white alabastrum(diploid) 2	0.609
	CNS0095596	Whole white alabastrum(diploid) 3	0.084
	CNS0095597	Whole white alabastrum(diploid) 4	0.010
	CNS0095598	Silvery flower (diploied) 1	0.476
	CNS0095599	Silvery flower (diploied) 2	0.127
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.209
	CNS0095602	Golden flower (diploid) 2	0.306
	CNS0095603	Golden flower (diploid) 3	0.158
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.029
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.119
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.577
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.488
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.275
	CNS0095610	Silvery flower (tetraploid) 1	1.216
	CNS0095611	Silvery flower (tetraploid) 2	1.755
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.702
	CNS0095614	Golden flower (tetraploid) 2	0.486
	CNS0095615	Golden flower (tetraploid) 3	0.191
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.064
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.180
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.016
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.007
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.584
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.058
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000