Gene detail

Detail information of GWHGAAZE004969

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011090258.1	1.14115E-91	PREDICTED: molybdopterin synthase catalytic subunit [Sesamum indicum]
Swissprot	tr\|O22827\|MOC2B_ARATH	1E-86	Molybdopterin synthase catalytic subunit {ECO:0000255\|HAMAP-Rule:MF_03052}
trEMBL	tr\|A0A059AAE9\|A0A059AAE9_EUCGR	4E-90	Molybdopterin synthase catalytic subunit {ECO:0000256\|HAMAP-Rule:MF_03052}
TAIR10	AT2G43760.3	1E-61	molybdopterin biosynthesis MoaE family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	421865	422404	+
GWHAAZE00000002	mRNA	421865	422404	+
GWHAAZE00000002	exon	421865	422404	+
GWHAAZE00000002	CDS	421865	422404	+

Transcript Sequence
>GWHTAAZE004975 ATGGCCAATGAGGAGAAAAATTTAATCGAAATCTTAGAAGAGAATAACCCTATCAACATCTCCAAGTACATAAATTATGTCCACTCTCAACAATGCGGTGCTATAGCAACTTTCTCCGGCACAACCCGAGATGCCTTTCAGGGAAAAATGGTAGTGGAGCTGCGCTACGAAGCATATGTGCCCATGGCAGTACGCTGCATCCAGTCGATCTGTTCGTTCGCCCGATCATCATGGTCCCTCAATGCAATTGCGGTGGCCCATCGTCTGGGACCAGTCCCAGTAGGGGAAACAAGCGTATTTATTGTGATTTCGGCCATTCATAGGGCTGATGCGCTGGACGCGTGTAAGTATGTGATTGATGAGATCAAGGCATCGGTTCCTATATGGAAGAAGGAAGTTTACACCAATGGGGAGGTTTGGAAGGAGAATTCGGAGTTTTTGGAGAGAAGAGGGGAACTTAAAAAGGGTTGCTGCGGGATGAAGGTAACGGTAGATGATGGAGCACTGAATTCTTGCCCTGCTAAAGGACGAGGGATTTGA

Network for GWHGAAZE004969

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02391.18	MoaE	15	124	8.30E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03635	MOCS2B, moaE	Metabolic pathways	map01100
		Folate biosynthesis	map00790
		Sulfur relay system	map04122

Gene Ontology

GO term	Ontology	Name
GO:0006777	biological_process	Mo-molybdopterin cofactor biosynthetic process
GO:0005829	cellular_component	cytosol
GO:0019008	cellular_component	molybdopterin synthase complex
GO:0030366	molecular_function	molybdopterin synthase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.478
	SRR3591706	second leaf	2.858
	SRR3591707	mature leaf	3.844
	SRR3591708	Shoot apex	16.182
	SRR3591709	Stem	14.669
	SRR3591710	White floral bud	12.596
	SRR3591711	White flower	19.617
	SRR3591712	Green floral bud	17.818
	SRR3591713	Yellow flower	17.250
SRP173429	SRR8316895	Juvenile bud stage	8.817
	SRR8316896	Juvenile bud stage	14.658
	SRR8316897	Juvenile bud stage	6.030
	SRR8316894	Third green stage	5.196
	SRR8316900	Third green stage	18.561
	SRR8316901	Third green stage	18.334
	SRR8316898	Complete white stage	5.364
	SRR8316899	Complete white stage	21.854
	SRR8316903	Complete white stage	8.017
	SRR8316902	Silver flowering stage	6.130
	SRR8316904	Silver flowering stage	6.865
	SRR8316905	Silver flowering stage	3.754
	SRR8316906	Gold flowering stage	10.513
	SRR8316907	Gold flowering stage	11.700
	SRR8316908	Gold flowering stage	11.696
SRP132670	SRR6706286	Control	18.038
	SRR6706287	Light intensity 50%	18.968
	SRR6706288	Light intensity 20%	19.500
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.666
	CNS0095593	Slightly white alabastrum(diploid) 2	17.473
	CNS0095594	Slightly white alabastrum(diploid) 3	12.797
	CNS0095595	Whole white alabastrum(diploid) 2	11.776
	CNS0095596	Whole white alabastrum(diploid) 3	15.023
	CNS0095597	Whole white alabastrum(diploid) 4	14.158
	CNS0095598	Silvery flower (diploied) 1	9.742
	CNS0095599	Silvery flower (diploied) 2	6.929
	CNS0095600	Silvery flower (diploied) 3	11.506
	CNS0095601	Golden flower (diploid) 1	9.927
	CNS0095602	Golden flower (diploid) 2	10.107
	CNS0095603	Golden flower (diploid) 3	10.414
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.613
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.080
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.453
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.005
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.342
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.240
	CNS0095610	Silvery flower (tetraploid) 1	13.961
	CNS0095611	Silvery flower (tetraploid) 2	15.148
	CNS0095612	Silvery flower (tetraploid) 3	14.430
	CNS0095613	Golden flower (tetraploid) 1	11.492
	CNS0095614	Golden flower (tetraploid) 2	11.848
	CNS0095615	Golden flower (tetraploid) 3	14.078
CRA001975	CRR073297	Stem 1	17.271
	CRR073298	Stem 2	15.492
	CRR073299	Stem 3	17.310
	CRR073300	Leaf 1	18.452
	CRR073301	Leaf 2	18.109
	CRR073302	Leaf 3	17.863
	CRR073303	Juvenile bud 1	19.587
	CRR073304	Juvenile bud 2	15.538
	CRR073305	Juvenile bud 3	17.083
	CRR073306	Third green 1	13.488
	CRR073307	Third green 2	13.350
	CRR073308	Third green 3	13.928
	CRR073309	Second white 1	10.113
	CRR073310	Second white 2	11.089
	CRR073311	Second white 3	6.477
	CRR073312	Silver flowering 1	6.953
	CRR073313	Silver flowering 2	8.191
	CRR073314	Silver flowering 3	6.245
	CRR073315	Gold flowering 1	8.178
	CRR073316	Gold flowering 2	12.205
	CRR073317	Gold flowering 3	8.095
	CRR073318	Tawny withering 1	9.081
	CRR073319	Tawny withering 2	10.052
	CRR073320	Tawny withering 3	9.766