Gene detail

Detail information of GWHGAAZE004997

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009591005.1	8.30016E-75	PREDICTED: succinate-semialdehyde dehydrogenase, mitochondrial isoform X2 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9SAK4\|SSDH_ARATH	2E-65	Succinate-semialdehyde dehydrogenase, mitochondrial (Precursor)
trEMBL	tr\|A0A076KWH0\|A0A076KWH0_TOBAC	4E-75	Succinic semialdehyde dehydrogenase {ECO:0000313\|EMBL:AII99846.1}
TAIR10	AT1G79440.1	2E-50	aldehyde dehydrogenase 5F1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	974280	978108	-
GWHAAZE00000002	mRNA	974280	978108	-
GWHAAZE00000002	exon	974280	974453	-
GWHAAZE00000002	exon	974590	974652	-
GWHAAZE00000002	exon	977361	977471	-
GWHAAZE00000002	exon	977573	977660	-
GWHAAZE00000002	exon	977921	977974	-
GWHAAZE00000002	exon	978071	978108	-
GWHAAZE00000002	CDS	978071	978108	-
GWHAAZE00000002	CDS	977921	977974	-
GWHAAZE00000002	CDS	977573	977660	-
GWHAAZE00000002	CDS	977361	977471	-
GWHAAZE00000002	CDS	974590	974652	-
GWHAAZE00000002	CDS	974280	974453	-

Transcript Sequence
>GWHTAAZE005003 ATGGGATTCTTCCGGAAGATTGGGTTTCCCTTGATTCAAGAAGATTACACAGAATTTAGAGTTTCTCCTGCTTTTTCATTTCCTCTGGGAATGTATGATTTAATACTTGCCCACAAGGAAGAGCTTGGACAACTTATGACTTTAGAGCAAGGAAAGCCTTTAAAAGAAGCCATAGGAGAGGTTACCTATGGTGCCAGTTTCATTGAGTTCTTTGCAGAAGAAGCTAAACGTGTATATGGAGATATAATTCCATCGACACTAGCTGATCGTCGTCTATTTGTTTTAAAGCAGCCAGTGGGTGTTGTTGGTGCAATTACACCCTGGAATTTTCCCTTGGCTATGATTACTCGAAAGGTTGGTCCTGCCCTTGCTTCTGGCTGTACAGTGGTCATAAAACCCTCTGAACTTACACCCTTGACTGCTTTGGCAGCAGCTGAGCTCTCCCTTCAAGCTGGAATTCCACCGGTAACTCTTATATATAGTCATAAATATACGCATATGTACATATGCAGCACTTCCATTATGTGA

Network for GWHGAAZE004997

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00171.23	Aldedh	31	157	3.30E-43

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17761	SSADH	Metabolic pathways	map01100
		Butanoate metabolism	map00650
		Alanine, aspartate and glutamate metabolism	map00250

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.785
	SRR3591706	second leaf	19.650
	SRR3591707	mature leaf	21.408
	SRR3591708	Shoot apex	27.467
	SRR3591709	Stem	27.629
	SRR3591710	White floral bud	30.798
	SRR3591711	White flower	32.436
	SRR3591712	Green floral bud	47.687
	SRR3591713	Yellow flower	30.561
SRP173429	SRR8316895	Juvenile bud stage	20.296
	SRR8316896	Juvenile bud stage	25.940
	SRR8316897	Juvenile bud stage	13.471
	SRR8316894	Third green stage	15.253
	SRR8316900	Third green stage	49.724
	SRR8316901	Third green stage	45.230
	SRR8316898	Complete white stage	17.903
	SRR8316899	Complete white stage	50.182
	SRR8316903	Complete white stage	28.557
	SRR8316902	Silver flowering stage	10.560
	SRR8316904	Silver flowering stage	16.136
	SRR8316905	Silver flowering stage	8.785
	SRR8316906	Gold flowering stage	26.501
	SRR8316907	Gold flowering stage	29.745
	SRR8316908	Gold flowering stage	23.894
SRP132670	SRR6706286	Control	39.660
	SRR6706287	Light intensity 50%	37.562
	SRR6706288	Light intensity 20%	41.909
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.648
	CNS0095593	Slightly white alabastrum(diploid) 2	16.019
	CNS0095594	Slightly white alabastrum(diploid) 3	15.217
	CNS0095595	Whole white alabastrum(diploid) 2	21.672
	CNS0095596	Whole white alabastrum(diploid) 3	27.796
	CNS0095597	Whole white alabastrum(diploid) 4	20.398
	CNS0095598	Silvery flower (diploied) 1	24.384
	CNS0095599	Silvery flower (diploied) 2	21.174
	CNS0095600	Silvery flower (diploied) 3	48.530
	CNS0095601	Golden flower (diploid) 1	22.837
	CNS0095602	Golden flower (diploid) 2	41.051
	CNS0095603	Golden flower (diploid) 3	38.147
	CNS0095604	Slightly white alabastrum(tetraploid) 1	29.717
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.073
	CNS0095606	Slightly white alabastrum(tetraploid) 3	49.945
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.251
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.743
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.626
	CNS0095610	Silvery flower (tetraploid) 1	34.885
	CNS0095611	Silvery flower (tetraploid) 2	51.694
	CNS0095612	Silvery flower (tetraploid) 3	42.985
	CNS0095613	Golden flower (tetraploid) 1	15.959
	CNS0095614	Golden flower (tetraploid) 2	27.837
	CNS0095615	Golden flower (tetraploid) 3	48.910
CRA001975	CRR073297	Stem 1	36.839
	CRR073298	Stem 2	33.610
	CRR073299	Stem 3	35.695
	CRR073300	Leaf 1	45.021
	CRR073301	Leaf 2	37.365
	CRR073302	Leaf 3	41.072
	CRR073303	Juvenile bud 1	46.807
	CRR073304	Juvenile bud 2	46.213
	CRR073305	Juvenile bud 3	55.173
	CRR073306	Third green 1	24.803
	CRR073307	Third green 2	17.276
	CRR073308	Third green 3	17.979
	CRR073309	Second white 1	28.304
	CRR073310	Second white 2	14.393
	CRR073311	Second white 3	15.355
	CRR073312	Silver flowering 1	15.918
	CRR073313	Silver flowering 2	19.416
	CRR073314	Silver flowering 3	16.939
	CRR073315	Gold flowering 1	19.385
	CRR073316	Gold flowering 2	22.094
	CRR073317	Gold flowering 3	19.636
	CRR073318	Tawny withering 1	23.681
	CRR073319	Tawny withering 2	10.717
	CRR073320	Tawny withering 3	19.439