Gene detail

Detail information of GWHGAAZE005079

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002311983.2	1.6317E-84	NAC domain-containing protein 78 [Populus trichocarpa]
Swissprot	tr\|Q84K00\|NAC78_ARATH	8E-71	NAC domain-containing protein 78
trEMBL	tr\|B9HL68\|B9HL68_POPTR	6E-85	NAC domain-containing protein 78 {ECO:0000313\|EMBL:EEE89350.2}
TAIR10	AT5G04410.1	4E-60	NAC domain containing protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	2373780	2375011	+
GWHAAZE00000002	mRNA	2373780	2375011	+
GWHAAZE00000002	exon	2373780	2374088	+
GWHAAZE00000002	exon	2374808	2375011	+
GWHAAZE00000002	CDS	2373780	2374088	+
GWHAAZE00000002	CDS	2374808	2375011	+

Transcript Sequence
>GWHTAAZE005085 ATGAATTGTTTGATTTACGGCGTGAATTTAGGTAAATCTAGGCTGAAGAGTAGAGATCTGGAGTGGTATTTTTTCACTGTGCTTGATAAGAAGTATGGAAACGGATCAAAGACGAACAGGGCAACTCATAGGGGTTACTGGAAGACCACGGGGAAGGACCGGGCTGTGTACCATAGGTCGAATGTTGTTGGGATGAAAAAAACTTTGGTGTATCATAATGGTAGGGCTCCTCGAGGTGAGAGGACTAATTGGGTCATGCATGAATACAGACTTATTGATGAGGAGTTAGACAAGTCCGGAATTGTTCAGGATGCGTTTGTGCTCTGCCGGGTATTTCAAAAGAGTGGCTCTGGGCCAAAGAATGGGGAGAAATATGGGGCACCATTTGTTGAGGAGGAATGGGAGGATGAAGAGTTGGCAATGGTCCCCAAGGAGGAGTCCACAGAGGAAGTACCAGTTGGTGATGGTGCCTATCTGGATGAAAATGACCTTCAGCAGGTTTGTAAATCTTGA

Network for GWHGAAZE005079

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0281

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	15	91	2.50E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.601
	SRR3591706	second leaf	23.248
	SRR3591707	mature leaf	27.939
	SRR3591708	Shoot apex	23.908
	SRR3591709	Stem	58.429
	SRR3591710	White floral bud	50.495
	SRR3591711	White flower	64.286
	SRR3591712	Green floral bud	38.931
	SRR3591713	Yellow flower	66.769
SRP173429	SRR8316895	Juvenile bud stage	22.133
	SRR8316896	Juvenile bud stage	31.534
	SRR8316897	Juvenile bud stage	13.795
	SRR8316894	Third green stage	15.535
	SRR8316900	Third green stage	43.521
	SRR8316901	Third green stage	39.377
	SRR8316898	Complete white stage	22.192
	SRR8316899	Complete white stage	60.737
	SRR8316903	Complete white stage	41.505
	SRR8316902	Silver flowering stage	30.140
	SRR8316904	Silver flowering stage	49.150
	SRR8316905	Silver flowering stage	22.617
	SRR8316906	Gold flowering stage	73.630
	SRR8316907	Gold flowering stage	65.688
	SRR8316908	Gold flowering stage	69.995
SRP132670	SRR6706286	Control	75.261
	SRR6706287	Light intensity 50%	67.742
	SRR6706288	Light intensity 20%	66.489
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.774
	CNS0095593	Slightly white alabastrum(diploid) 2	18.764
	CNS0095594	Slightly white alabastrum(diploid) 3	14.220
	CNS0095595	Whole white alabastrum(diploid) 2	18.068
	CNS0095596	Whole white alabastrum(diploid) 3	13.503
	CNS0095597	Whole white alabastrum(diploid) 4	13.819
	CNS0095598	Silvery flower (diploied) 1	23.643
	CNS0095599	Silvery flower (diploied) 2	30.116
	CNS0095600	Silvery flower (diploied) 3	72.870
	CNS0095601	Golden flower (diploid) 1	21.996
	CNS0095602	Golden flower (diploid) 2	63.826
	CNS0095603	Golden flower (diploid) 3	64.956
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.445
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.858
	CNS0095606	Slightly white alabastrum(tetraploid) 3	54.787
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.514
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.043
	CNS0095609	Whole white alabastrum(tetraploid) 3	38.205
	CNS0095610	Silvery flower (tetraploid) 1	86.089
	CNS0095611	Silvery flower (tetraploid) 2	66.130
	CNS0095612	Silvery flower (tetraploid) 3	47.621
	CNS0095613	Golden flower (tetraploid) 1	49.296
	CNS0095614	Golden flower (tetraploid) 2	70.146
	CNS0095615	Golden flower (tetraploid) 3	61.039
CRA001975	CRR073297	Stem 1	30.271
	CRR073298	Stem 2	31.656
	CRR073299	Stem 3	29.561
	CRR073300	Leaf 1	39.814
	CRR073301	Leaf 2	37.435
	CRR073302	Leaf 3	26.706
	CRR073303	Juvenile bud 1	32.090
	CRR073304	Juvenile bud 2	37.218
	CRR073305	Juvenile bud 3	46.587
	CRR073306	Third green 1	28.171
	CRR073307	Third green 2	22.656
	CRR073308	Third green 3	28.177
	CRR073309	Second white 1	26.743
	CRR073310	Second white 2	26.363
	CRR073311	Second white 3	28.161
	CRR073312	Silver flowering 1	26.648
	CRR073313	Silver flowering 2	31.539
	CRR073314	Silver flowering 3	26.906
	CRR073315	Gold flowering 1	17.754
	CRR073316	Gold flowering 2	31.231
	CRR073317	Gold flowering 3	21.455
	CRR073318	Tawny withering 1	20.717
	CRR073319	Tawny withering 2	23.143
	CRR073320	Tawny withering 3	19.030