Gene detail

Detail information of GWHGAAZE005160

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10580.1	1.56121E-44	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8RX29\|ATL70_ARATH	2E-34	RING-H2 finger protein ATL70
trEMBL	tr\|A0A068UPW0\|A0A068UPW0_COFCA	6E-45	Coffea canephora DH200=94 genomic scaffold, scaffold_45 {ECO:0000313\|EMBL:CDP10580.1}
TAIR10	AT2G35910.1	9E-29	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	3606042	3606515	+
GWHAAZE00000002	mRNA	3606042	3606515	+
GWHAAZE00000002	exon	3606042	3606515	+
GWHAAZE00000002	CDS	3606042	3606515	+

Transcript Sequence
>GWHTAAZE005166 ATGGGAAGTGAAACTCTTGGTGGCTATAGCTACACTATGGGTGTTTTCTTTGGTGTATTTGTAATCATCCTAATCCTCACTTACGTTTCCAACGTGTGTAACCTTTTGCGCTCTGCTGATAATCCGGCCTTGCCCCACACCATTCCAGCTGACACCTCCACTGATGACAACTCAACTAGCATGGGTCTAGGCCTTGACGACGCCACCCTAATTGCGTGCCCAAAGTTTCTCTACTCGGATATTGGTAAGCTCCTTGATGGCGGCTCCACCGTCTCCGGCTGCTCTATCTGCTTAGCAAAATACAGATCTGCTGACGTGATCCGGCTGTTACCGGACTGCGGCCACCTGTTTCACCTCCAATGCATTGACACATGGCTGAGGGTTCATCCAACTTGTCCAATCTGTCGAAACTCACCGATAGCTAATCCGTTGGCAACTTCTCTGGCCCAAGTGGCCCCATTGGCAACTGTATAA

Network for GWHGAAZE005160

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	94	136	4.70E-14

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.192
	SRR3591706	second leaf	0.132
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.859
	SRR3591709	Stem	1.800
	SRR3591710	White floral bud	1.608
	SRR3591711	White flower	0.318
	SRR3591712	Green floral bud	1.552
	SRR3591713	Yellow flower	0.956
SRP173429	SRR8316895	Juvenile bud stage	0.187
	SRR8316896	Juvenile bud stage	0.794
	SRR8316897	Juvenile bud stage	0.117
	SRR8316894	Third green stage	0.328
	SRR8316900	Third green stage	0.596
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.199
	SRR8316899	Complete white stage	0.595
	SRR8316903	Complete white stage	0.723
	SRR8316902	Silver flowering stage	0.594
	SRR8316904	Silver flowering stage	0.600
	SRR8316905	Silver flowering stage	0.378
	SRR8316906	Gold flowering stage	0.748
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.627
	SRR6706287	Light intensity 50%	0.604
	SRR6706288	Light intensity 20%	0.334
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.478
	CNS0095593	Slightly white alabastrum(diploid) 2	1.530
	CNS0095594	Slightly white alabastrum(diploid) 3	0.777
	CNS0095595	Whole white alabastrum(diploid) 2	0.869
	CNS0095596	Whole white alabastrum(diploid) 3	0.132
	CNS0095597	Whole white alabastrum(diploid) 4	0.863
	CNS0095598	Silvery flower (diploied) 1	0.820
	CNS0095599	Silvery flower (diploied) 2	0.986
	CNS0095600	Silvery flower (diploied) 3	0.496
	CNS0095601	Golden flower (diploid) 1	0.850
	CNS0095602	Golden flower (diploid) 2	0.272
	CNS0095603	Golden flower (diploid) 3	0.592
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.073
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.650
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.657
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.722
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.113
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.863
	CNS0095610	Silvery flower (tetraploid) 1	0.244
	CNS0095611	Silvery flower (tetraploid) 2	0.291
	CNS0095612	Silvery flower (tetraploid) 3	0.915
	CNS0095613	Golden flower (tetraploid) 1	1.931
	CNS0095614	Golden flower (tetraploid) 2	1.140
	CNS0095615	Golden flower (tetraploid) 3	0.741
CRA001975	CRR073297	Stem 1	0.430
	CRR073298	Stem 2	1.170
	CRR073299	Stem 3	0.177
	CRR073300	Leaf 1	1.230
	CRR073301	Leaf 2	2.223
	CRR073302	Leaf 3	0.274
	CRR073303	Juvenile bud 1	0.403
	CRR073304	Juvenile bud 2	0.355
	CRR073305	Juvenile bud 3	0.281
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.369
	CRR073308	Third green 3	0.138
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.497
	CRR073311	Second white 3	0.835
	CRR073312	Silver flowering 1	0.285
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.263
	CRR073319	Tawny withering 2	1.213
	CRR073320	Tawny withering 3	0.093