Gene detail

Detail information of GWHGAAZE005287

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAG27612.1	1.34356E-81	putative calmodulin-like protein [Populus x canadensis]
Swissprot	tr\|Q9SVG9\|CML42_ARATH	2E-80	Calcium-binding protein CML42
trEMBL	tr\|Q6ZXI3\|Q6ZXI3_POPCA	5E-82	Putative calmodulin-like protein {ECO:0000313\|EMBL:CAG27612.1}
TAIR10	AT4G20780.1	2E-64	calmodulin like 42

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	5517543	5518124	+
GWHAAZE00000002	mRNA	5517543	5518124	+
GWHAAZE00000002	exon	5517543	5518124	+
GWHAAZE00000002	CDS	5517543	5518124	+

Transcript Sequence
>GWHTAAZE005293 ATGGCTACAAATATCACTATTACCAAGAAGCCTTCATCCAATTCATCCTTCAGTCTTCGTTGCCCTAGTCTCAACGCCCTCCGCCTCCGTCGAATCTTCGATGTGTTCGACAAAAATGCCGATGGATTGCTCACCGTTGACGAATTCAGCCAGGCTCTCAGCCTCCTTGGCCTTGATGCCGACCGATCGGAACTGGAGACTATGGTAGAGTCCTACATTCAACCTGGCAATGCCGGCCTTAGATTCGAGGATTTCGAAGCCCTACACCGCTCTTTGAATGATGTATTCTTCGGCATCGACGATAATAATCTCGAGGCTGCAGAACAGGATAACGAACAAGCGAGGGCTTCGCAAGAAGAATCTGATCTGAAGGAGGCTTTTAAGGTGTTCGATGAGGACGGAGATGGTTATATATCGGCGAGGGAATTGCAAACCGTGCTAAGGAAGTTAGGCTTTCCGGAGGGAATAGAGCTCGAGAGAGTGGAGAAGATGATCTCGTCCGTTGATCGGAACAGTGACGGGCGTGTTGATTTCCTGGAGTTCAAGGATATGATGCGTAGTGTGGTGGTTCTGCCCTATTGA

Network for GWHGAAZE005287

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13405.7	EF-hand_6	28	57	7.10E-07
PF13499.7	EF-hand_7	121	186	8.60E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.581
	SRR3591706	second leaf	1.981
	SRR3591707	mature leaf	1.377
	SRR3591708	Shoot apex	6.964
	SRR3591709	Stem	0.820
	SRR3591710	White floral bud	36.225
	SRR3591711	White flower	3.320
	SRR3591712	Green floral bud	132.555
	SRR3591713	Yellow flower	0.719
SRP173429	SRR8316895	Juvenile bud stage	18.820
	SRR8316896	Juvenile bud stage	68.256
	SRR8316897	Juvenile bud stage	50.747
	SRR8316894	Third green stage	32.576
	SRR8316900	Third green stage	133.764
	SRR8316901	Third green stage	147.842
	SRR8316898	Complete white stage	3.886
	SRR8316899	Complete white stage	8.029
	SRR8316903	Complete white stage	5.979
	SRR8316902	Silver flowering stage	2.917
	SRR8316904	Silver flowering stage	4.543
	SRR8316905	Silver flowering stage	1.170
	SRR8316906	Gold flowering stage	4.367
	SRR8316907	Gold flowering stage	3.947
	SRR8316908	Gold flowering stage	3.540
SRP132670	SRR6706286	Control	58.058
	SRR6706287	Light intensity 50%	55.292
	SRR6706288	Light intensity 20%	51.374
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	148.656
	CNS0095593	Slightly white alabastrum(diploid) 2	113.909
	CNS0095594	Slightly white alabastrum(diploid) 3	201.266
	CNS0095595	Whole white alabastrum(diploid) 2	166.414
	CNS0095596	Whole white alabastrum(diploid) 3	210.546
	CNS0095597	Whole white alabastrum(diploid) 4	178.848
	CNS0095598	Silvery flower (diploied) 1	7.667
	CNS0095599	Silvery flower (diploied) 2	8.433
	CNS0095600	Silvery flower (diploied) 3	4.011
	CNS0095601	Golden flower (diploid) 1	7.406
	CNS0095602	Golden flower (diploid) 2	4.282
	CNS0095603	Golden flower (diploid) 3	4.026
	CNS0095604	Slightly white alabastrum(tetraploid) 1	189.292
	CNS0095605	Slightly white alabastrum(tetraploid) 2	208.429
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.252
	CNS0095607	Whole white alabastrum(tetraploid) 1	244.941
	CNS0095608	Whole white alabastrum(tetraploid) 2	230.258
	CNS0095609	Whole white alabastrum(tetraploid) 3	123.801
	CNS0095610	Silvery flower (tetraploid) 1	2.303
	CNS0095611	Silvery flower (tetraploid) 2	5.990
	CNS0095612	Silvery flower (tetraploid) 3	7.840
	CNS0095613	Golden flower (tetraploid) 1	2.482
	CNS0095614	Golden flower (tetraploid) 2	4.722
	CNS0095615	Golden flower (tetraploid) 3	2.272
CRA001975	CRR073297	Stem 1	39.647
	CRR073298	Stem 2	44.244
	CRR073299	Stem 3	26.434
	CRR073300	Leaf 1	108.010
	CRR073301	Leaf 2	96.864
	CRR073302	Leaf 3	77.388
	CRR073303	Juvenile bud 1	57.004
	CRR073304	Juvenile bud 2	72.961
	CRR073305	Juvenile bud 3	5.513
	CRR073306	Third green 1	43.278
	CRR073307	Third green 2	46.494
	CRR073308	Third green 3	39.321
	CRR073309	Second white 1	17.473
	CRR073310	Second white 2	18.670
	CRR073311	Second white 3	17.908
	CRR073312	Silver flowering 1	31.854
	CRR073313	Silver flowering 2	23.358
	CRR073314	Silver flowering 3	26.446
	CRR073315	Gold flowering 1	9.771
	CRR073316	Gold flowering 2	3.824
	CRR073317	Gold flowering 3	4.021
	CRR073318	Tawny withering 1	19.862
	CRR073319	Tawny withering 2	17.394
	CRR073320	Tawny withering 3	13.154