Gene detail

Detail information of GWHGAAZE005309

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007033512.1	3.39835E-73	WRKY DNA-binding protein 70, putative isoform 1 [Theobroma cacao]
Swissprot	tr\|Q9LY00\|WRK70_ARATH	1E-38	Probable WRKY transcription factor 70
trEMBL	tr\|A0A061EIE6\|A0A061EIE6_THECC	1E-73	WRKY DNA-binding protein 70, putative isoform 1 {ECO:0000313\|EMBL:EOY04438.1}
TAIR10	AT3G56400.1	3E-27	WRKY DNA-binding protein 70

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	5846414	5848447	+
GWHAAZE00000002	mRNA	5846414	5848447	+
GWHAAZE00000002	exon	5846414	5846634	+
GWHAAZE00000002	exon	5847053	5847157	+
GWHAAZE00000002	exon	5847544	5847794	+
GWHAAZE00000002	exon	5848386	5848447	+
GWHAAZE00000002	CDS	5846414	5846634	+
GWHAAZE00000002	CDS	5847053	5847157	+
GWHAAZE00000002	CDS	5847544	5847794	+
GWHAAZE00000002	CDS	5848386	5848447	+

Transcript Sequence
>GWHTAAZE005315 ATGCTTTCTAAAACCGTTAAAGGCGAAGAAGGATCGATGTTCCCCGAGGATCTAGTTATGAAGATCTTAGAATCATTCACCGAAACACTTTCAATTCTAAAATCTACAAACTCCGACGAGGTTTCTCAATTTCCGGCAGGTTTGGGTTGCCGGAAATATGAAGATTCTGGCGAAAGTAGCAAGACTTCGGTTAAAGATCGGAGGGGATGTTACAAGAGAAGGAAGACATCCCAAACAACAACAAAACTTACTCCCACATTGATTGATGATGGATTTGCATGGAGAAAGTATGGACAAAAATCAATCCACAATACCAATCACCCAAGGAACTATTATAGGTGCACCCACAAATTTGATCAAGGGTGCCAAGCAACCAAACAGGTCCAAAGAACCGAAGATGACCCGCCAATGTACCGGACCACATACAACGGCCACCACACGTGCCGTAATTTACTTAAATCTCCTCAAATCATCTTGGATCCAACGGCCAAGGATTCCTCAATCCTTCTCAGCTTTGGAACAGACGACCCGACCCACAAACCTGACGGCCCATTCTTCCCCATAATAAAACAAGAAAATCCTCCTGGATATGATCCTATTAATTTTGCTAATAGGTTCAACTCCTCTTTACATATATAA

Network for GWHGAAZE005309

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03106.16	WRKY	89	149	3.70E-26

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	WRKY

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	45.424
	SRR3591706	second leaf	74.457
	SRR3591707	mature leaf	77.429
	SRR3591708	Shoot apex	63.807
	SRR3591709	Stem	147.681
	SRR3591710	White floral bud	46.277
	SRR3591711	White flower	142.545
	SRR3591712	Green floral bud	38.210
	SRR3591713	Yellow flower	60.161
SRP173429	SRR8316895	Juvenile bud stage	50.890
	SRR8316896	Juvenile bud stage	65.438
	SRR8316897	Juvenile bud stage	33.012
	SRR8316894	Third green stage	5.419
	SRR8316900	Third green stage	19.512
	SRR8316901	Third green stage	52.191
	SRR8316898	Complete white stage	7.114
	SRR8316899	Complete white stage	140.548
	SRR8316903	Complete white stage	18.899
	SRR8316902	Silver flowering stage	27.375
	SRR8316904	Silver flowering stage	27.141
	SRR8316905	Silver flowering stage	17.153
	SRR8316906	Gold flowering stage	34.437
	SRR8316907	Gold flowering stage	45.285
	SRR8316908	Gold flowering stage	34.200
SRP132670	SRR6706286	Control	117.893
	SRR6706287	Light intensity 50%	97.295
	SRR6706288	Light intensity 20%	74.252
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	74.860
	CNS0095593	Slightly white alabastrum(diploid) 2	73.758
	CNS0095594	Slightly white alabastrum(diploid) 3	69.466
	CNS0095595	Whole white alabastrum(diploid) 2	40.030
	CNS0095596	Whole white alabastrum(diploid) 3	22.150
	CNS0095597	Whole white alabastrum(diploid) 4	31.580
	CNS0095598	Silvery flower (diploied) 1	78.377
	CNS0095599	Silvery flower (diploied) 2	51.152
	CNS0095600	Silvery flower (diploied) 3	68.991
	CNS0095601	Golden flower (diploid) 1	100.747
	CNS0095602	Golden flower (diploid) 2	122.014
	CNS0095603	Golden flower (diploid) 3	119.630
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.378
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.242
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.203
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.682
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.925
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.919
	CNS0095610	Silvery flower (tetraploid) 1	52.854
	CNS0095611	Silvery flower (tetraploid) 2	44.034
	CNS0095612	Silvery flower (tetraploid) 3	34.501
	CNS0095613	Golden flower (tetraploid) 1	28.188
	CNS0095614	Golden flower (tetraploid) 2	34.384
	CNS0095615	Golden flower (tetraploid) 3	13.719
CRA001975	CRR073297	Stem 1	49.688
	CRR073298	Stem 2	44.351
	CRR073299	Stem 3	30.653
	CRR073300	Leaf 1	18.332
	CRR073301	Leaf 2	37.578
	CRR073302	Leaf 3	23.272
	CRR073303	Juvenile bud 1	15.809
	CRR073304	Juvenile bud 2	13.212
	CRR073305	Juvenile bud 3	37.607
	CRR073306	Third green 1	95.316
	CRR073307	Third green 2	64.423
	CRR073308	Third green 3	78.469
	CRR073309	Second white 1	30.384
	CRR073310	Second white 2	34.283
	CRR073311	Second white 3	17.001
	CRR073312	Silver flowering 1	7.350
	CRR073313	Silver flowering 2	10.324
	CRR073314	Silver flowering 3	4.329
	CRR073315	Gold flowering 1	334.465
	CRR073316	Gold flowering 2	505.074
	CRR073317	Gold flowering 3	264.724
	CRR073318	Tawny withering 1	112.513
	CRR073319	Tawny withering 2	190.962
	CRR073320	Tawny withering 3	73.572