Gene detail

Detail information of GWHGAAZE005474

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006339282.1	1.77349E-43	PREDICTED: copper transporter 4-like [Solanum tuberosum]
Swissprot	tr\|Q39065\|COPT1_ARATH	1E-37	Copper transporter 1
trEMBL	tr\|M1ARQ4\|M1ARQ4_SOLTU	6E-44	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400028798}
TAIR10	AT5G59030.1	1E-15	copper transporter 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	8496569	8496964	+
GWHAAZE00000002	mRNA	8496569	8496964	+
GWHAAZE00000002	exon	8496569	8496964	+
GWHAAZE00000002	CDS	8496569	8496964	+

Transcript Sequence
>GWHTAAZE005482 ATGCCACCGCCCAACGCCACCAGCGGTGGCATACACCCCCACCACAAGACCACCTTCCTGCACTTCTACTGGGGCAAGAATGCCGAATTCCTATTCTCGGGTTGGCCTGGAAACAGCTCGGGTATGTACGCCTTGGCTCTGATCTTCGTCTTCCTATTGGCGTTCTTTGTCGAGTTACTCTCTCACTTCGATCTCATCAAACCGAGCGCAAACCGGGTTGCTTCGGCTTTTCTCCAGACTGGTATTTACGCGGTTCGGGCCGGGCTAGCCTACATGGTGATGCTGGCGGTCATGTCTTATAATGGCGGTGTGTTTCTCGCAGCCGTCGCGGGTCATGCCGTCGGTTTCTTTGTTTTTAAATGCCTGGTTTTCAGCAAAGGTTCGGGCTTTGGGTAA

Network for GWHGAAZE005474

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04145.16	Ctr	21	61	1.50E-08
PF04145.16	Ctr	72	119	1.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14686	SLC31A1, CTR1	Mineral absorption	map04978

Gene Ontology

GO term	Ontology	Name
GO:0035434	biological_process	copper ion transmembrane transport
GO:0016021	cellular_component	integral component of membrane
GO:0005375	molecular_function	copper ion transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.996
	SRR3591706	second leaf	2.307
	SRR3591707	mature leaf	0.538
	SRR3591708	Shoot apex	4.287
	SRR3591709	Stem	9.936
	SRR3591710	White floral bud	0.562
	SRR3591711	White flower	0.209
	SRR3591712	Green floral bud	0.659
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.563
	SRR8316896	Juvenile bud stage	3.022
	SRR8316897	Juvenile bud stage	1.718
	SRR8316894	Third green stage	0.713
	SRR8316900	Third green stage	0.111
	SRR8316901	Third green stage	1.240
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.624
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.032
	SRR8316905	Silver flowering stage	0.173
	SRR8316906	Gold flowering stage	0.158
	SRR8316907	Gold flowering stage	0.284
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.195
	SRR6706288	Light intensity 20%	0.049
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.985
	CNS0095593	Slightly white alabastrum(diploid) 2	2.084
	CNS0095594	Slightly white alabastrum(diploid) 3	5.044
	CNS0095595	Whole white alabastrum(diploid) 2	2.811
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.315
	CNS0095598	Silvery flower (diploied) 1	1.009
	CNS0095599	Silvery flower (diploied) 2	0.351
	CNS0095600	Silvery flower (diploied) 3	0.398
	CNS0095601	Golden flower (diploid) 1	0.210
	CNS0095602	Golden flower (diploid) 2	0.546
	CNS0095603	Golden flower (diploid) 3	0.304
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.348
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.317
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.169
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.097
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.322
	CRR073298	Stem 2	0.835
	CRR073299	Stem 3	2.322
	CRR073300	Leaf 1	1.977
	CRR073301	Leaf 2	1.682
	CRR073302	Leaf 3	0.660
	CRR073303	Juvenile bud 1	0.282
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.356
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.370
	CRR073316	Gold flowering 2	0.030
	CRR073317	Gold flowering 3	0.105
	CRR073318	Tawny withering 1	9.689
	CRR073319	Tawny withering 2	9.409
	CRR073320	Tawny withering 3	7.485