Gene detail

Detail information of GWHGAAZE005475

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007026856.1	1.84482E-50	Copper transporter, putative [Theobroma cacao]
Swissprot	tr\|Q8GWP3\|COPT6_ARATH	4E-30	Copper transporter 6
trEMBL	tr\|A0A061ERR1\|A0A061ERR1_THECC	7E-51	Copper transporter, putative {ECO:0000313\|EMBL:EOY07358.1}
TAIR10	AT2G26975.1	5E-23	Ctr copper transporter family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	8517930	8518379	+
GWHAAZE00000002	mRNA	8517930	8518379	+
GWHAAZE00000002	exon	8517930	8518379	+
GWHAAZE00000002	CDS	8517930	8518379	+

Transcript Sequence
>GWHTAAZE005483 ATGGAGGACATGCCGATGCCCATGACTCCACCCGGTGCTCCAATGTCAAACGTCACCATGAAGGGCATGGCGATGCACACAAGCTTCTTCTGGGGCAGTAACGTTACTATCTTATTCCAAGGTTGGCCCGACAACAACCTCGGCATGTACATACTCTCTCTCGTATTTGTATTCTTGCTGTCCGCCGCCGTAGAGGTCTTGTCGGTCCCACTGGCTGTCAAGCCGGGGATCAGTCCAGTGGTGGGCGGTTTCACTCAGTCAGCGGTTTATGCCCTCCGAATGGCACTTGCTTACATGGTGATGTTGTCAGTTATGTCGTTCAACCTCGGAGTCTTCATCGTTGCCGTCACCGGCCATACTTTGGGGTTTTTTTTGGTCAAGTTCCGTGCACTTTCTTTGGCATCTTCTCAAGCTGCCGCGGCCACTGAAAATAATTTTCCTAAAGTTTGA

Network for GWHGAAZE005475

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04145.16	Ctr	28	68	4.70E-07
PF04145.16	Ctr	84	125	8.90E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14686	SLC31A1, CTR1	Mineral absorption	map04978

Gene Ontology

GO term	Ontology	Name
GO:0035434	biological_process	copper ion transmembrane transport
GO:0016021	cellular_component	integral component of membrane
GO:0005375	molecular_function	copper ion transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.806
	SRR3591706	second leaf	57.203
	SRR3591707	mature leaf	79.811
	SRR3591708	Shoot apex	50.698
	SRR3591709	Stem	63.340
	SRR3591710	White floral bud	9.757
	SRR3591711	White flower	19.998
	SRR3591712	Green floral bud	10.726
	SRR3591713	Yellow flower	10.199
SRP173429	SRR8316895	Juvenile bud stage	19.280
	SRR8316896	Juvenile bud stage	26.389
	SRR8316897	Juvenile bud stage	8.873
	SRR8316894	Third green stage	7.329
	SRR8316900	Third green stage	15.133
	SRR8316901	Third green stage	15.883
	SRR8316898	Complete white stage	10.559
	SRR8316899	Complete white stage	26.278
	SRR8316903	Complete white stage	10.594
	SRR8316902	Silver flowering stage	8.532
	SRR8316904	Silver flowering stage	7.763
	SRR8316905	Silver flowering stage	4.642
	SRR8316906	Gold flowering stage	15.701
	SRR8316907	Gold flowering stage	19.277
	SRR8316908	Gold flowering stage	7.869
SRP132670	SRR6706286	Control	32.114
	SRR6706287	Light intensity 50%	25.893
	SRR6706288	Light intensity 20%	27.288
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.565
	CNS0095593	Slightly white alabastrum(diploid) 2	32.252
	CNS0095594	Slightly white alabastrum(diploid) 3	29.355
	CNS0095595	Whole white alabastrum(diploid) 2	28.594
	CNS0095596	Whole white alabastrum(diploid) 3	20.275
	CNS0095597	Whole white alabastrum(diploid) 4	20.724
	CNS0095598	Silvery flower (diploied) 1	71.813
	CNS0095599	Silvery flower (diploied) 2	43.527
	CNS0095600	Silvery flower (diploied) 3	24.505
	CNS0095601	Golden flower (diploid) 1	59.052
	CNS0095602	Golden flower (diploid) 2	58.345
	CNS0095603	Golden flower (diploid) 3	53.021
	CNS0095604	Slightly white alabastrum(tetraploid) 1	22.349
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.963
	CNS0095606	Slightly white alabastrum(tetraploid) 3	37.343
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.159
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.003
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.070
	CNS0095610	Silvery flower (tetraploid) 1	23.944
	CNS0095611	Silvery flower (tetraploid) 2	24.598
	CNS0095612	Silvery flower (tetraploid) 3	11.182
	CNS0095613	Golden flower (tetraploid) 1	22.190
	CNS0095614	Golden flower (tetraploid) 2	20.613
	CNS0095615	Golden flower (tetraploid) 3	17.877
CRA001975	CRR073297	Stem 1	47.198
	CRR073298	Stem 2	57.414
	CRR073299	Stem 3	72.123
	CRR073300	Leaf 1	21.052
	CRR073301	Leaf 2	30.467
	CRR073302	Leaf 3	27.637
	CRR073303	Juvenile bud 1	23.322
	CRR073304	Juvenile bud 2	12.081
	CRR073305	Juvenile bud 3	33.430
	CRR073306	Third green 1	32.134
	CRR073307	Third green 2	27.658
	CRR073308	Third green 3	29.614
	CRR073309	Second white 1	24.315
	CRR073310	Second white 2	23.321
	CRR073311	Second white 3	18.868
	CRR073312	Silver flowering 1	13.712
	CRR073313	Silver flowering 2	13.867
	CRR073314	Silver flowering 3	13.057
	CRR073315	Gold flowering 1	267.153
	CRR073316	Gold flowering 2	212.198
	CRR073317	Gold flowering 3	304.131
	CRR073318	Tawny withering 1	98.739
	CRR073319	Tawny withering 2	86.841
	CRR073320	Tawny withering 3	101.006