Gene detail

Detail information of GWHGAAZE005519

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011096194.1	6.6865E-161	PREDICTED: cytochrome b-c1 complex subunit Rieske-4, mitochondrial-like [Sesamum indicum]
Swissprot	tr\|P51132\|UCRI2_TOBAC	8E-152	Cytochrome b-c1 complex subunit Rieske-2, mitochondrial (Precursor)
trEMBL	tr\|A0A022QII7\|A0A022QII7_ERYGU	1E-156	Cytochrome b-c1 complex subunit Rieske, mitochondrial {ECO:0000256\|RuleBase:RU004494}
TAIR10	AT5G13430.1	1E-109	Ubiquinol-cytochrome C reductase iron-sulfur subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	9283551	9286316	-
GWHAAZE00000002	mRNA	9283551	9286316	-
GWHAAZE00000002	exon	9283551	9284191	-
GWHAAZE00000002	exon	9286133	9286316	-
GWHAAZE00000002	CDS	9286133	9286316	-
GWHAAZE00000002	CDS	9283551	9284191	-

Transcript Sequence
>GWHTAAZE005527 ATGTTGAGAGTTGCAGGTAGGAGGCTTTCTTCTTCTATTTCATGGCGTTCCAATCGTCCTTCCTCTGCGGCCTTCATCGCTTCAAATCCAATCAACGGCCTAGATTCTCCATCCGATGATGTCCCCAGATCGATCAATCAATGGTCTACCTCCCTCACTTCCGGCTTTCTGGATCAAATTAGAGGGTTCTCTTCTGATTCCCTCGCTCCAGTACATGACAGTTTGATCTCAGATATCCCGCCCACAATTGCAGCTGTCAAGAATCCCACGTCAAAAATCGTGTATGATGAGCACAACCACGAGAGGTACCCACCTGGTGACCCAAGCAAACGTGCATTTGCGTACTTCGTGTTGACAGGTGGTAGGTTTGTGTATGCTTCATTGATCCGTCTCCTTGTCCTAAAGTTTGTACTGAGCATGTCGGCCAGTAAGGATGTTCTTGCTCTAGCCTCACTTGAGGTAGATCTCTCTAGCATAGAGCCTGGTTCCACCGTTACTGTCAAGTGGCGTGGGAAGCCAGTCTTCATCAGGCGTCGAACAGAGGATGACATCAAATTGGCCAACAGTGTTGATATAAGCTCCCTTAGGGACCCACAGGAGGACTCGGCAAGGGTCAAGAATCCAGAATGGCTGGTGGTGGTTGGAGTGTGCACCCATCTTGGTTGCATCCCCTTACCCAACGCTGGTGACTTTGGGGGTTGGTTCTGCCCGTGCCATGGATCCCACTATGATATCTCAGGAAGGATCCGTAAAGGACCAGCACCGTACAATCTGGAGGTACCCACCTACAGCTTCATGGAGGACAACAAGTTACTTGTTGGTTGA

Network for GWHGAAZE005519

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0160

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02921.15	UCR_TM	89	145	6.60E-13
PF00355.27	Rieske	157	260	4.80E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00411	UQCRFS1, RIP1, petA	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Two-component system	map02020
		Cardiac muscle contraction	map04260
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016020	cellular_component	membrane
GO:0008121	molecular_function	ubiquinol-cytochrome-c reductase activity
GO:0016491	molecular_function	oxidoreductase activity
GO:0051537	molecular_function	2 iron, 2 sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	289.636
	SRR3591706	second leaf	159.136
	SRR3591707	mature leaf	95.227
	SRR3591708	Shoot apex	213.870
	SRR3591709	Stem	212.417
	SRR3591710	White floral bud	458.003
	SRR3591711	White flower	513.631
	SRR3591712	Green floral bud	416.739
	SRR3591713	Yellow flower	415.809
SRP173429	SRR8316895	Juvenile bud stage	196.007
	SRR8316896	Juvenile bud stage	300.767
	SRR8316897	Juvenile bud stage	155.365
	SRR8316894	Third green stage	127.124
	SRR8316900	Third green stage	508.068
	SRR8316901	Third green stage	472.716
	SRR8316898	Complete white stage	278.066
	SRR8316899	Complete white stage	441.470
	SRR8316903	Complete white stage	354.531
	SRR8316902	Silver flowering stage	357.676
	SRR8316904	Silver flowering stage	365.759
	SRR8316905	Silver flowering stage	215.045
	SRR8316906	Gold flowering stage	807.712
	SRR8316907	Gold flowering stage	927.422
	SRR8316908	Gold flowering stage	926.407
SRP132670	SRR6706286	Control	558.117
	SRR6706287	Light intensity 50%	583.108
	SRR6706288	Light intensity 20%	600.799
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	244.622
	CNS0095593	Slightly white alabastrum(diploid) 2	292.535
	CNS0095594	Slightly white alabastrum(diploid) 3	240.168
	CNS0095595	Whole white alabastrum(diploid) 2	272.776
	CNS0095596	Whole white alabastrum(diploid) 3	288.282
	CNS0095597	Whole white alabastrum(diploid) 4	255.910
	CNS0095598	Silvery flower (diploied) 1	197.652
	CNS0095599	Silvery flower (diploied) 2	208.547
	CNS0095600	Silvery flower (diploied) 3	513.131
	CNS0095601	Golden flower (diploid) 1	188.032
	CNS0095602	Golden flower (diploid) 2	394.625
	CNS0095603	Golden flower (diploid) 3	399.686
	CNS0095604	Slightly white alabastrum(tetraploid) 1	326.165
	CNS0095605	Slightly white alabastrum(tetraploid) 2	281.126
	CNS0095606	Slightly white alabastrum(tetraploid) 3	334.561
	CNS0095607	Whole white alabastrum(tetraploid) 1	307.865
	CNS0095608	Whole white alabastrum(tetraploid) 2	342.001
	CNS0095609	Whole white alabastrum(tetraploid) 3	427.377
	CNS0095610	Silvery flower (tetraploid) 1	588.519
	CNS0095611	Silvery flower (tetraploid) 2	511.888
	CNS0095612	Silvery flower (tetraploid) 3	671.057
	CNS0095613	Golden flower (tetraploid) 1	408.244
	CNS0095614	Golden flower (tetraploid) 2	385.722
	CNS0095615	Golden flower (tetraploid) 3	569.956
CRA001975	CRR073297	Stem 1	384.669
	CRR073298	Stem 2	386.275
	CRR073299	Stem 3	497.501
	CRR073300	Leaf 1	522.471
	CRR073301	Leaf 2	565.542
	CRR073302	Leaf 3	773.830
	CRR073303	Juvenile bud 1	744.029
	CRR073304	Juvenile bud 2	1013.411
	CRR073305	Juvenile bud 3	739.331
	CRR073306	Third green 1	1340.979
	CRR073307	Third green 2	1291.551
	CRR073308	Third green 3	996.439
	CRR073309	Second white 1	1886.727
	CRR073310	Second white 2	1050.870
	CRR073311	Second white 3	837.584
	CRR073312	Silver flowering 1	1033.416
	CRR073313	Silver flowering 2	1435.829
	CRR073314	Silver flowering 3	1039.034
	CRR073315	Gold flowering 1	211.838
	CRR073316	Gold flowering 2	204.362
	CRR073317	Gold flowering 3	251.376
	CRR073318	Tawny withering 1	388.138
	CRR073319	Tawny withering 2	349.182
	CRR073320	Tawny withering 3	322.732