Gene detail

Detail information of GWHGAAZE005544

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009621777.1	1.50214E-61	PREDICTED: putative calcium-binding protein CML19 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9FIH9\|CML37_ARATH	4E-53	Calcium-binding protein CML37
trEMBL	tr\|M1A5H1\|M1A5H1_SOLTU	3E-62	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400015111}
TAIR10	AT5G42380.1	5E-43	calmodulin like 37

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	9713779	9714381	+
GWHAAZE00000002	mRNA	9713779	9714381	+
GWHAAZE00000002	exon	9713779	9714381	+
GWHAAZE00000002	CDS	9713779	9714381	+

Transcript Sequence
>GWHTAAZE005552 ATGAAACTAGAGGACTCTGTTTCACCAAGCTCTTCATCATCGGAGATTAGTATCACTAAATTCAATTCTTCTCCCAAATCTGCCATCCGAAGATTGTATCGTAAGTTGTCCACTTGGAAATCTCAATCGAAACGGTCTCTACCTATGGAGCGTGCGGCGGAGGTAGATTTTGTTGATCGAGAGTACTGCAACAATCTGATCCGGCAAGTGTTCACGCACTTCGATGAAGACGGCGATGGGAAGATATCGGCGGCGGAGTTAGAGAGCTGCGTGAGGACGGTGGGAGGTGAAATTACGCCGGAAGAAGCGGAATTGGCGGTTCGATCGTCGGATTCCGACGGAGACGGGAAATTAGGGCTAGAGGACTTTGCGAAGCTGATGGAGGCAAGTGGAGAGGAGGAGAGGAATTATGAGTTGAAGGAGGCGTTTGGGATGTACGCGATGGAGGGGAGCGAGCGTATTACGCCGATGAGTTTGAAGAGGATGTTGAGTCGACTGGGTGAATCCACATCCATCGACAACTGTAAAGCCATGATTCGCCAGTTTGACCTCAATGGAGATGGCGTTCTTACCTTCGACGAATTTAGCATAATGATGCATTAA

Network for GWHGAAZE005544

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	67	127	2.30E-12
PF13833.7	EF-hand_8	152	199	5.40E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.988
	SRR3591706	second leaf	3.360
	SRR3591707	mature leaf	8.635
	SRR3591708	Shoot apex	10.405
	SRR3591709	Stem	20.350
	SRR3591710	White floral bud	4.237
	SRR3591711	White flower	4.491
	SRR3591712	Green floral bud	3.792
	SRR3591713	Yellow flower	2.032
SRP173429	SRR8316895	Juvenile bud stage	283.371
	SRR8316896	Juvenile bud stage	538.597
	SRR8316897	Juvenile bud stage	233.850
	SRR8316894	Third green stage	16.653
	SRR8316900	Third green stage	35.410
	SRR8316901	Third green stage	146.696
	SRR8316898	Complete white stage	2.428
	SRR8316899	Complete white stage	57.121
	SRR8316903	Complete white stage	3.738
	SRR8316902	Silver flowering stage	8.014
	SRR8316904	Silver flowering stage	3.974
	SRR8316905	Silver flowering stage	5.382
	SRR8316906	Gold flowering stage	25.090
	SRR8316907	Gold flowering stage	24.532
	SRR8316908	Gold flowering stage	6.697
SRP132670	SRR6706286	Control	16.082
	SRR6706287	Light intensity 50%	10.009
	SRR6706288	Light intensity 20%	7.527
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.651
	CNS0095593	Slightly white alabastrum(diploid) 2	9.783
	CNS0095594	Slightly white alabastrum(diploid) 3	12.038
	CNS0095595	Whole white alabastrum(diploid) 2	11.511
	CNS0095596	Whole white alabastrum(diploid) 3	2.220
	CNS0095597	Whole white alabastrum(diploid) 4	7.303
	CNS0095598	Silvery flower (diploied) 1	32.481
	CNS0095599	Silvery flower (diploied) 2	531.701
	CNS0095600	Silvery flower (diploied) 3	201.094
	CNS0095601	Golden flower (diploid) 1	698.539
	CNS0095602	Golden flower (diploid) 2	235.660
	CNS0095603	Golden flower (diploid) 3	247.617
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.589
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.236
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.438
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.378
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.429
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.273
	CNS0095610	Silvery flower (tetraploid) 1	5.882
	CNS0095611	Silvery flower (tetraploid) 2	14.021
	CNS0095612	Silvery flower (tetraploid) 3	2.171
	CNS0095613	Golden flower (tetraploid) 1	5.578
	CNS0095614	Golden flower (tetraploid) 2	6.066
	CNS0095615	Golden flower (tetraploid) 3	0.362
CRA001975	CRR073297	Stem 1	3.406
	CRR073298	Stem 2	8.226
	CRR073299	Stem 3	5.914
	CRR073300	Leaf 1	23.455
	CRR073301	Leaf 2	31.328
	CRR073302	Leaf 3	18.039
	CRR073303	Juvenile bud 1	27.903
	CRR073304	Juvenile bud 2	25.048
	CRR073305	Juvenile bud 3	70.678
	CRR073306	Third green 1	3.579
	CRR073307	Third green 2	5.625
	CRR073308	Third green 3	1.436
	CRR073309	Second white 1	3.107
	CRR073310	Second white 2	1.677
	CRR073311	Second white 3	1.052
	CRR073312	Silver flowering 1	2.286
	CRR073313	Silver flowering 2	3.316
	CRR073314	Silver flowering 3	1.475
	CRR073315	Gold flowering 1	5.314
	CRR073316	Gold flowering 2	2.224
	CRR073317	Gold flowering 3	6.592
	CRR073318	Tawny withering 1	9.824
	CRR073319	Tawny withering 2	14.249
	CRR073320	Tawny withering 3	22.922