Gene detail

Detail information of GWHGAAZE005545

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009621777.1	3.70904E-63	PREDICTED: putative calcium-binding protein CML19 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9FIH9\|CML37_ARATH	4E-46	Calcium-binding protein CML37
trEMBL	tr\|K4C9A1\|K4C9A1_SOLLC	7E-63	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc06g073830.1.1}
TAIR10	AT5G42380.1	2E-36	calmodulin like 37

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	9718263	9718820	+
GWHAAZE00000002	mRNA	9718263	9718820	+
GWHAAZE00000002	exon	9718263	9718820	+
GWHAAZE00000002	CDS	9718263	9718820	+

Transcript Sequence
>GWHTAAZE005553 ATGGGATCAGAGGACTCTGTTTCTTCAACTTCATCATCATCGGAAATCACCATCAATGAATCCAATTCTTCTCCGATTAGAAGATTGTACCGCAAATTTTCATCTAGGCAAAGTCACGAAAAACAGTCTCCGGTTTCGTTGAAGGCCAATATAATCGAGCGAGTGTTCATGTACTTCGACGAGGACGGCGACGGGAAGATATCTGCGGCGGAGTTGGAGAGCTGCGTGAGGACGGTGGGAGGGGAAATTACGCGGGAAGAGGCGCAATTGGCGGTGGAATCGTCGGATTCGGACGGAGACGGGAGGTTAGGGCTTGAGGACTTTGCGAAGCTTATGGAGGCAAGTGGAGAGGAGGAGAAGAATGGGGAGTTGAAGGAGGCGTTTGGAATGTACGCATTGGAGGGGAGCGAGTGTATTACGCCTAAGAGTTTGAAGATGATGCTGAGTCGACTCGGCGAGTCTACCTCGATTGACAACTGTAAGGCCATGATTGGCAAGTTTGACCTCAATGGAGATGGCGTTCTCAACTTTGACGAGTTTAGAATTATGATGCATTGA

Network for GWHGAAZE005545

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	52	112	2.00E-12
PF13833.7	EF-hand_8	136	184	1.20E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	71.297
	SRR3591706	second leaf	12.179
	SRR3591707	mature leaf	7.243
	SRR3591708	Shoot apex	53.830
	SRR3591709	Stem	62.798
	SRR3591710	White floral bud	23.271
	SRR3591711	White flower	41.831
	SRR3591712	Green floral bud	11.901
	SRR3591713	Yellow flower	33.288
SRP173429	SRR8316895	Juvenile bud stage	87.111
	SRR8316896	Juvenile bud stage	65.694
	SRR8316897	Juvenile bud stage	74.194
	SRR8316894	Third green stage	25.960
	SRR8316900	Third green stage	27.951
	SRR8316901	Third green stage	72.960
	SRR8316898	Complete white stage	1.507
	SRR8316899	Complete white stage	71.912
	SRR8316903	Complete white stage	1.630
	SRR8316902	Silver flowering stage	4.124
	SRR8316904	Silver flowering stage	2.022
	SRR8316905	Silver flowering stage	10.117
	SRR8316906	Gold flowering stage	64.963
	SRR8316907	Gold flowering stage	36.130
	SRR8316908	Gold flowering stage	17.329
SRP132670	SRR6706286	Control	1.844
	SRR6706287	Light intensity 50%	1.528
	SRR6706288	Light intensity 20%	0.887
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	49.301
	CNS0095593	Slightly white alabastrum(diploid) 2	85.515
	CNS0095594	Slightly white alabastrum(diploid) 3	80.626
	CNS0095595	Whole white alabastrum(diploid) 2	53.695
	CNS0095596	Whole white alabastrum(diploid) 3	9.183
	CNS0095597	Whole white alabastrum(diploid) 4	37.711
	CNS0095598	Silvery flower (diploied) 1	237.499
	CNS0095599	Silvery flower (diploied) 2	190.489
	CNS0095600	Silvery flower (diploied) 3	45.623
	CNS0095601	Golden flower (diploid) 1	144.128
	CNS0095602	Golden flower (diploid) 2	54.611
	CNS0095603	Golden flower (diploid) 3	56.101
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.416
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.310
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.145
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.677
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.129
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.218
	CNS0095610	Silvery flower (tetraploid) 1	6.877
	CNS0095611	Silvery flower (tetraploid) 2	2.319
	CNS0095612	Silvery flower (tetraploid) 3	18.025
	CNS0095613	Golden flower (tetraploid) 1	7.402
	CNS0095614	Golden flower (tetraploid) 2	3.683
	CNS0095615	Golden flower (tetraploid) 3	7.635
CRA001975	CRR073297	Stem 1	48.158
	CRR073298	Stem 2	71.206
	CRR073299	Stem 3	61.663
	CRR073300	Leaf 1	109.131
	CRR073301	Leaf 2	152.977
	CRR073302	Leaf 3	89.957
	CRR073303	Juvenile bud 1	69.632
	CRR073304	Juvenile bud 2	79.683
	CRR073305	Juvenile bud 3	128.302
	CRR073306	Third green 1	35.534
	CRR073307	Third green 2	27.462
	CRR073308	Third green 3	22.304
	CRR073309	Second white 1	28.261
	CRR073310	Second white 2	26.885
	CRR073311	Second white 3	20.700
	CRR073312	Silver flowering 1	67.111
	CRR073313	Silver flowering 2	50.245
	CRR073314	Silver flowering 3	39.828
	CRR073315	Gold flowering 1	32.029
	CRR073316	Gold flowering 2	24.404
	CRR073317	Gold flowering 3	30.797
	CRR073318	Tawny withering 1	13.694
	CRR073319	Tawny withering 2	38.761
	CRR073320	Tawny withering 3	24.043