Gene detail

Detail information of GWHGAAZE005561

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU28273.1	1.2893E-80	hypothetical protein MIMGU_mgv1a015602mg [Erythranthe guttata]
Swissprot	tr\|Q9M531\|H2A_EUPES	2E-72	Histone H2A
trEMBL	tr\|A0A022QLV9\|A0A022QLV9_ERYGU	5E-81	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT5G02560.1	6E-45	histone H2A 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	9993817	9994758	+
GWHAAZE00000002	mRNA	9993817	9994758	+
GWHAAZE00000002	exon	9993817	9994002	+
GWHAAZE00000002	exon	9994513	9994758	+
GWHAAZE00000002	CDS	9993817	9994002	+
GWHAAZE00000002	CDS	9994513	9994758	+

Transcript Sequence
>GWHTAAZE005569 ATGGAAACCGGTGGAAAAATGAAGAAAGGTGCAGCAGGAAGGAAAGGAGGCGGTCCAAAGAAGAAGCCGGTGTCCCGGTCCGTCAAGGCCGGACTTCAGTTTCCGGTCGGAAGGATCGGCCGGTACCTGAAGAAAGGCCGTTATGCTCAGCGCGTTGGTACCGGAGCTCCGGTCTATCTTGCAGCTGTATTGGAGCTGGCTGGGAATGCGGCAAGGGACAACAAGAAGAACAGGATAATACCAAGGCATGTGCTACTGGCAGTGAGGAATGATGAAGAGCTAGGGAAGCTGCTAGCTGGGGTTACGATTGCACATGGAGGTGTGCTTCCTAACATAAACCCAGTCCTCCTTCCTAAGAAGGCTGAAAAGGCTTCTTCAGGCAAGGAAGCTACCAAGTCTCCCAAGGCCACTAAATCTCCGAAGAAGGCTTAA

Network for GWHGAAZE005561

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16211.6	Histone_H2A_C	92	125	1.10E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	203.989
	SRR3591706	second leaf	132.621
	SRR3591707	mature leaf	96.866
	SRR3591708	Shoot apex	593.136
	SRR3591709	Stem	139.380
	SRR3591710	White floral bud	124.407
	SRR3591711	White flower	120.578
	SRR3591712	Green floral bud	93.489
	SRR3591713	Yellow flower	98.101
SRP173429	SRR8316895	Juvenile bud stage	86.394
	SRR8316896	Juvenile bud stage	87.516
	SRR8316897	Juvenile bud stage	40.629
	SRR8316894	Third green stage	26.324
	SRR8316900	Third green stage	67.200
	SRR8316901	Third green stage	77.839
	SRR8316898	Complete white stage	56.909
	SRR8316899	Complete white stage	128.893
	SRR8316903	Complete white stage	93.469
	SRR8316902	Silver flowering stage	55.994
	SRR8316904	Silver flowering stage	62.080
	SRR8316905	Silver flowering stage	46.479
	SRR8316906	Gold flowering stage	137.661
	SRR8316907	Gold flowering stage	138.315
	SRR8316908	Gold flowering stage	138.111
SRP132670	SRR6706286	Control	171.200
	SRR6706287	Light intensity 50%	149.821
	SRR6706288	Light intensity 20%	157.264
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	135.187
	CNS0095593	Slightly white alabastrum(diploid) 2	124.255
	CNS0095594	Slightly white alabastrum(diploid) 3	118.426
	CNS0095595	Whole white alabastrum(diploid) 2	79.886
	CNS0095596	Whole white alabastrum(diploid) 3	65.157
	CNS0095597	Whole white alabastrum(diploid) 4	56.497
	CNS0095598	Silvery flower (diploied) 1	156.462
	CNS0095599	Silvery flower (diploied) 2	131.017
	CNS0095600	Silvery flower (diploied) 3	157.053
	CNS0095601	Golden flower (diploid) 1	157.683
	CNS0095602	Golden flower (diploid) 2	187.527
	CNS0095603	Golden flower (diploid) 3	179.571
	CNS0095604	Slightly white alabastrum(tetraploid) 1	125.538
	CNS0095605	Slightly white alabastrum(tetraploid) 2	106.772
	CNS0095606	Slightly white alabastrum(tetraploid) 3	193.235
	CNS0095607	Whole white alabastrum(tetraploid) 1	80.666
	CNS0095608	Whole white alabastrum(tetraploid) 2	35.391
	CNS0095609	Whole white alabastrum(tetraploid) 3	73.840
	CNS0095610	Silvery flower (tetraploid) 1	148.680
	CNS0095611	Silvery flower (tetraploid) 2	198.439
	CNS0095612	Silvery flower (tetraploid) 3	141.995
	CNS0095613	Golden flower (tetraploid) 1	153.552
	CNS0095614	Golden flower (tetraploid) 2	148.066
	CNS0095615	Golden flower (tetraploid) 3	291.311
CRA001975	CRR073297	Stem 1	195.364
	CRR073298	Stem 2	194.690
	CRR073299	Stem 3	351.077
	CRR073300	Leaf 1	110.674
	CRR073301	Leaf 2	140.806
	CRR073302	Leaf 3	152.862
	CRR073303	Juvenile bud 1	114.182
	CRR073304	Juvenile bud 2	103.622
	CRR073305	Juvenile bud 3	155.046
	CRR073306	Third green 1	76.325
	CRR073307	Third green 2	103.491
	CRR073308	Third green 3	87.784
	CRR073309	Second white 1	69.149
	CRR073310	Second white 2	54.209
	CRR073311	Second white 3	64.821
	CRR073312	Silver flowering 1	90.977
	CRR073313	Silver flowering 2	89.437
	CRR073314	Silver flowering 3	71.735
	CRR073315	Gold flowering 1	165.668
	CRR073316	Gold flowering 2	178.593
	CRR073317	Gold flowering 3	235.966
	CRR073318	Tawny withering 1	257.905
	CRR073319	Tawny withering 2	254.580
	CRR073320	Tawny withering 3	287.777