Gene detail

Detail information of GWHGAAZE005817

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10634.1	8.72067E-91	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SIH5\|FB322_ARATH	2E-73	Probable F-box protein At1g60180
trEMBL	tr\|A0A068UQV8\|A0A068UQV8_COFCA	3E-91	Coffea canephora DH200=94 genomic scaffold, scaffold_45 {ECO:0000313\|EMBL:CDP10634.1}
TAIR10	AT2G36090.1	3E-51	F-box family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	14402719	14403393	-
GWHAAZE00000002	mRNA	14402719	14403393	-
GWHAAZE00000002	exon	14403179	14403393	-
GWHAAZE00000002	exon	14402719	14403139	-
GWHAAZE00000002	CDS	14403179	14403393	-
GWHAAZE00000002	CDS	14402719	14403139	-

Transcript Sequence
>GWHTAAZE005825 ATGTCACTCCTTCCCTCCACCAGCGCCGCTGCTGTAGAAGGCAGCGCCCCCGCTATCTCCGCCCTGCACCCGGACATATTGGAGGCCCACATCCTCACCCGCCTTGACGGCCCCACCCTCGCCTCCTCCAGCTGCGCCGCCACCACACTCCTCTCTCTCTCTTCCCAAGACCACCTCTGGTCCGAAATCTGCCGCTCCACGTGGCCCTCCACCTCAGGCGGCCCCCGCTCCTTCTTCGCCCACTCCTATCCCCTCCCAGACCCCACCCCCGCCACGTCGGCGTCATCATCCCCAACGCCACCGGAATTAATCTCGGGCGTTGATATTCATTACAAGAAGAAATTAATTTTCACGAAAGTTGAAGCAACGGAAACCGTTACCGGTTGGTTCCGGTGCTCGCCCTTCAGAATTGACCTTTTAGACCCCAAGGACGCGGTCCCCACAAAGATACAGCACCCGGACGGGGAAAAAAAGTGTACGGACCTGGTCAACGACATGACGCTGAGCTGGATTTTAATGGATCCGATCGGAGGGCGGTCGGTGAATCTGTCGTCACACAGGCCTGTTTCGGTGGAGCGGCACTGGTTGAGTGGGGAGGTGCAGGTGCGGTTCGCTTCAATCCTGGGCGTTGATGAG

Network for GWHGAAZE005817

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.610
	SRR3591706	second leaf	4.460
	SRR3591707	mature leaf	1.051
	SRR3591708	Shoot apex	1.082
	SRR3591709	Stem	1.030
	SRR3591710	White floral bud	2.343
	SRR3591711	White flower	1.424
	SRR3591712	Green floral bud	2.443
	SRR3591713	Yellow flower	0.723
SRP173429	SRR8316895	Juvenile bud stage	0.425
	SRR8316896	Juvenile bud stage	0.685
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.208
	SRR8316900	Third green stage	0.185
	SRR8316901	Third green stage	0.310
	SRR8316898	Complete white stage	0.340
	SRR8316899	Complete white stage	0.373
	SRR8316903	Complete white stage	0.217
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.074
	SRR8316905	Silver flowering stage	0.092
	SRR8316906	Gold flowering stage	0.085
	SRR8316907	Gold flowering stage	0.149
	SRR8316908	Gold flowering stage	0.072
SRP132670	SRR6706286	Control	0.714
	SRR6706287	Light intensity 50%	0.502
	SRR6706288	Light intensity 20%	0.750
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.829
	CNS0095593	Slightly white alabastrum(diploid) 2	1.396
	CNS0095594	Slightly white alabastrum(diploid) 3	0.181
	CNS0095595	Whole white alabastrum(diploid) 2	0.222
	CNS0095596	Whole white alabastrum(diploid) 3	0.077
	CNS0095597	Whole white alabastrum(diploid) 4	0.319
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.600
	CNS0095600	Silvery flower (diploied) 3	0.450
	CNS0095601	Golden flower (diploid) 1	0.485
	CNS0095602	Golden flower (diploid) 2	0.556
	CNS0095603	Golden flower (diploid) 3	0.620
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.092
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.348
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.116
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.577
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.278
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.080
	CNS0095610	Silvery flower (tetraploid) 1	0.075
	CNS0095611	Silvery flower (tetraploid) 2	0.214
	CNS0095612	Silvery flower (tetraploid) 3	0.236
	CNS0095613	Golden flower (tetraploid) 1	0.101
	CNS0095614	Golden flower (tetraploid) 2	0.399
	CNS0095615	Golden flower (tetraploid) 3	0.416
CRA001975	CRR073297	Stem 1	0.505
	CRR073298	Stem 2	0.550
	CRR073299	Stem 3	0.494
	CRR073300	Leaf 1	0.332
	CRR073301	Leaf 2	0.227
	CRR073302	Leaf 3	0.380
	CRR073303	Juvenile bud 1	1.984
	CRR073304	Juvenile bud 2	0.175
	CRR073305	Juvenile bud 3	0.166
	CRR073306	Third green 1	0.206
	CRR073307	Third green 2	0.441
	CRR073308	Third green 3	0.222
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.264
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.048
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.274
	CRR073316	Gold flowering 2	1.001
	CRR073317	Gold flowering 3	0.451
	CRR073318	Tawny withering 1	0.504
	CRR073319	Tawny withering 2	1.916
	CRR073320	Tawny withering 3	0.527