Gene detail

Detail information of GWHGAAZE005926

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHM99880.1	3.11234E-82	30S ribosomal protein S6 alpha, chloroplastic [Glycine soja]
Swissprot	tr\|Q8VY91\|RR6_ARATH	3E-78	30S ribosomal protein S6 alpha, chloroplastic (Precursor)
trEMBL	tr\|A0A072TUR4\|A0A072TUR4_MEDTR	1E-82	Ribosomal protein S6 family protein {ECO:0000313\|EMBL:KEH21264.1}
TAIR10	AT1G64510.1	5E-53	Translation elongation factor EF1B/ribosomal protein S6 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	16333982	16336781	-
GWHAAZE00000002	mRNA	16333982	16336781	-
GWHAAZE00000002	exon	16333982	16334221	-
GWHAAZE00000002	exon	16336359	16336781	-
GWHAAZE00000002	CDS	16336359	16336781	-
GWHAAZE00000002	CDS	16333982	16334221	-

Transcript Sequence
>GWHTAAZE005934 ATGGCGTCTTCATCACTATCTTCAATCGTCGCCTCCTCTTCTCTTTCATCTACATTATTATTACCTCTCAAATCCTTCAAGCGATCATCATCTCTTTCATCCTTACCCGTCGCCTCATTCCCTCACACTTTGAGAGCCTTCACAAGGAAACCCAAATCAGTGAAATACGAGAGAAGAAACCCTCGTTTCTCCTCCATCAAATCCCAAACCCTAGATTTTGCGGACTCATTTTTCGACGGAGAATTCGAAGAGGAAGACGACAGCTATGACGATCCGATTGTACCAGTCTGGACGGACACGGACTTCGAGGAGAAGGAGGAGCCCGAGTGTCCGCCGGGTCTTAGAAAATACGAGACGATGGTCGTTTTGAGGCCTGATATGTCTGAAGATGAGAGGATTACTCTTACACAGAAGTACGAAGAGTTGCTTGTTAGTGGGGGTGGAATGTACGTGGAGGTATTTAACCGAGGGGTGATTCCTCTTGCCTATGACATCAAGAAGAGAAACAGAGCAGGAGAGAAAAACGTCTACATGCACGGTATCTATCTCTTGTTCACTTATTTCACCAAACCTGAATCACCTGCAGTCCTCGAAGAAACACTCAAGATGGATGACAATGTTATCCGATGGTCCACTTTCAAAATAAGGAAAAGGAAGTATTAA

Network for GWHGAAZE005926

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01250.18	Ribosomal_S6	116	214	2.20E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02990	RP-S6, MRPS6, rpsF	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.060
	SRR3591706	second leaf	11.816
	SRR3591707	mature leaf	10.459
	SRR3591708	Shoot apex	15.355
	SRR3591709	Stem	10.112
	SRR3591710	White floral bud	11.393
	SRR3591711	White flower	20.989
	SRR3591712	Green floral bud	20.293
	SRR3591713	Yellow flower	19.582
SRP173429	SRR8316895	Juvenile bud stage	10.247
	SRR8316896	Juvenile bud stage	32.995
	SRR8316897	Juvenile bud stage	11.484
	SRR8316894	Third green stage	5.913
	SRR8316900	Third green stage	23.337
	SRR8316901	Third green stage	17.964
	SRR8316898	Complete white stage	5.941
	SRR8316899	Complete white stage	14.596
	SRR8316903	Complete white stage	7.151
	SRR8316902	Silver flowering stage	6.463
	SRR8316904	Silver flowering stage	6.737
	SRR8316905	Silver flowering stage	3.423
	SRR8316906	Gold flowering stage	10.669
	SRR8316907	Gold flowering stage	15.311
	SRR8316908	Gold flowering stage	15.943
SRP132670	SRR6706286	Control	19.416
	SRR6706287	Light intensity 50%	17.015
	SRR6706288	Light intensity 20%	21.351
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.494
	CNS0095593	Slightly white alabastrum(diploid) 2	12.994
	CNS0095594	Slightly white alabastrum(diploid) 3	10.772
	CNS0095595	Whole white alabastrum(diploid) 2	13.460
	CNS0095596	Whole white alabastrum(diploid) 3	17.737
	CNS0095597	Whole white alabastrum(diploid) 4	9.956
	CNS0095598	Silvery flower (diploied) 1	14.706
	CNS0095599	Silvery flower (diploied) 2	29.817
	CNS0095600	Silvery flower (diploied) 3	18.057
	CNS0095601	Golden flower (diploid) 1	39.365
	CNS0095602	Golden flower (diploid) 2	20.688
	CNS0095603	Golden flower (diploid) 3	16.607
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.297
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.510
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.247
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.590
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.630
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.654
	CNS0095610	Silvery flower (tetraploid) 1	18.469
	CNS0095611	Silvery flower (tetraploid) 2	23.546
	CNS0095612	Silvery flower (tetraploid) 3	14.865
	CNS0095613	Golden flower (tetraploid) 1	14.704
	CNS0095614	Golden flower (tetraploid) 2	18.871
	CNS0095615	Golden flower (tetraploid) 3	4.554
CRA001975	CRR073297	Stem 1	9.707
	CRR073298	Stem 2	11.222
	CRR073299	Stem 3	15.415
	CRR073300	Leaf 1	10.941
	CRR073301	Leaf 2	13.399
	CRR073302	Leaf 3	22.985
	CRR073303	Juvenile bud 1	21.564
	CRR073304	Juvenile bud 2	14.382
	CRR073305	Juvenile bud 3	11.753
	CRR073306	Third green 1	3.000
	CRR073307	Third green 2	1.308
	CRR073308	Third green 3	3.209
	CRR073309	Second white 1	6.098
	CRR073310	Second white 2	6.198
	CRR073311	Second white 3	4.738
	CRR073312	Silver flowering 1	4.069
	CRR073313	Silver flowering 2	6.931
	CRR073314	Silver flowering 3	11.318
	CRR073315	Gold flowering 1	14.030
	CRR073316	Gold flowering 2	12.385
	CRR073317	Gold flowering 3	11.029
	CRR073318	Tawny withering 1	8.664
	CRR073319	Tawny withering 2	7.371
	CRR073320	Tawny withering 3	7.051