Gene detail

Detail information of GWHGAAZE005962

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12148.1	6.93983E-73	unnamed protein product [Coffea canephora]
Swissprot	tr\|O65665\|ERF60_ARATH	3E-40	Ethylene-responsive transcription factor ERF060
trEMBL	tr\|A0A068UWZ5\|A0A068UWZ5_COFCA	3E-73	Coffea canephora DH200=94 genomic scaffold, scaffold_62 {ECO:0000313\|EMBL:CDP12148.1}
TAIR10	AT1G64380.1	5E-26	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	16942138	16942773	+
GWHAAZE00000002	mRNA	16942138	16942773	+
GWHAAZE00000002	exon	16942138	16942384	+
GWHAAZE00000002	exon	16942415	16942773	+
GWHAAZE00000002	CDS	16942138	16942384	+
GWHAAZE00000002	CDS	16942415	16942773	+

Transcript Sequence
>GWHTAAZE005970 ATGACCAACCCAATTCAATCATCTTCATACACTAACAGCAACATCACTCCTCTTCCATTAAAGAAGAAACTATACAGAGGAGTGAGGCAGAGGCATTGGGGCAAATGGGTGGCTGAGATTAGACTCCCACAGAACAGAATGAGGGTTTGGTTGGGTACTTACGAAACAGCCGAGGCTGCTGCCTACGCCTATGATCGGGCAGCATATAAGCTACGTGGGGAGTATGCGCGTTTGAATTTCCCTAATCATGGAGCGAGATTGAATGCTCTGAAGAGTGCTGTGGATGCCAAGATTCAAGCTATTTGCCAGAAAATGAAGAGAGAGAAAGGGAACAAGAAGGGCAAGAAAATTGACAGCGGGAGTGAAAAAGCAATGAAGATCGATAATTCGAATTCTTCATCATTGTTATCGTCTTCGTTTGTTGGTAGTGGTGAAATGGTTTCATCGAGTGTTTCTAATGAGGGGTTGTGGAAAGGGGAAAACTCGCCGTGTTCGGTTTCAGGCGAGTTTCCGGTGGTGGCGGAGAGATCAGAGTTTGAGGATTGCTCGCTCGAGCATATGCCCTCGTTTGATCCGGAGTTGATCTGGGAAGTCCTTGCCAATTAG

Network for GWHGAAZE005962

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	25	74	1.90E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.211
	SRR3591706	second leaf	16.834
	SRR3591707	mature leaf	20.851
	SRR3591708	Shoot apex	7.711
	SRR3591709	Stem	6.905
	SRR3591710	White floral bud	67.793
	SRR3591711	White flower	81.902
	SRR3591712	Green floral bud	33.898
	SRR3591713	Yellow flower	22.040
SRP173429	SRR8316895	Juvenile bud stage	8.490
	SRR8316896	Juvenile bud stage	5.678
	SRR8316897	Juvenile bud stage	3.937
	SRR8316894	Third green stage	5.973
	SRR8316900	Third green stage	13.424
	SRR8316901	Third green stage	11.072
	SRR8316898	Complete white stage	11.177
	SRR8316899	Complete white stage	23.676
	SRR8316903	Complete white stage	19.866
	SRR8316902	Silver flowering stage	9.107
	SRR8316904	Silver flowering stage	13.429
	SRR8316905	Silver flowering stage	4.101
	SRR8316906	Gold flowering stage	5.994
	SRR8316907	Gold flowering stage	6.892
	SRR8316908	Gold flowering stage	6.862
SRP132670	SRR6706286	Control	12.637
	SRR6706287	Light intensity 50%	11.851
	SRR6706288	Light intensity 20%	11.292
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	24.011
	CNS0095593	Slightly white alabastrum(diploid) 2	27.978
	CNS0095594	Slightly white alabastrum(diploid) 3	18.148
	CNS0095595	Whole white alabastrum(diploid) 2	9.296
	CNS0095596	Whole white alabastrum(diploid) 3	6.659
	CNS0095597	Whole white alabastrum(diploid) 4	11.510
	CNS0095598	Silvery flower (diploied) 1	32.339
	CNS0095599	Silvery flower (diploied) 2	12.810
	CNS0095600	Silvery flower (diploied) 3	11.206
	CNS0095601	Golden flower (diploid) 1	12.023
	CNS0095602	Golden flower (diploid) 2	18.021
	CNS0095603	Golden flower (diploid) 3	16.363
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.321
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.487
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.818
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.407
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.519
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.021
	CNS0095610	Silvery flower (tetraploid) 1	19.639
	CNS0095611	Silvery flower (tetraploid) 2	8.408
	CNS0095612	Silvery flower (tetraploid) 3	10.664
	CNS0095613	Golden flower (tetraploid) 1	2.349
	CNS0095614	Golden flower (tetraploid) 2	17.346
	CNS0095615	Golden flower (tetraploid) 3	12.431
CRA001975	CRR073297	Stem 1	42.237
	CRR073298	Stem 2	44.736
	CRR073299	Stem 3	56.027
	CRR073300	Leaf 1	47.768
	CRR073301	Leaf 2	52.690
	CRR073302	Leaf 3	40.256
	CRR073303	Juvenile bud 1	40.452
	CRR073304	Juvenile bud 2	35.068
	CRR073305	Juvenile bud 3	41.952
	CRR073306	Third green 1	18.161
	CRR073307	Third green 2	31.900
	CRR073308	Third green 3	31.241
	CRR073309	Second white 1	6.620
	CRR073310	Second white 2	6.345
	CRR073311	Second white 3	3.840
	CRR073312	Silver flowering 1	2.528
	CRR073313	Silver flowering 2	2.085
	CRR073314	Silver flowering 3	3.562
	CRR073315	Gold flowering 1	11.070
	CRR073316	Gold flowering 2	11.830
	CRR073317	Gold flowering 3	7.188
	CRR073318	Tawny withering 1	14.848
	CRR073319	Tawny withering 2	21.408
	CRR073320	Tawny withering 3	22.897