Gene detail

Detail information of GWHGAAZE006024

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006343948.1	1.03107E-88	PREDICTED: E3 ubiquitin-protein ligase RHA1B-like [Solanum tuberosum]
Swissprot	tr\|Q9SUS5\|RHA1B_ARATH	4E-30	E3 ubiquitin-protein ligase RHA1B
trEMBL	tr\|M1AW79\|M1AW79_SOLTU	4E-89	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400031780}
TAIR10	AT3G61460.1	2E-46	brassinosteroid-responsive RING-H2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	18143299	18143799	+
GWHAAZE00000002	mRNA	18143299	18143799	+
GWHAAZE00000002	exon	18143299	18143799	+
GWHAAZE00000002	CDS	18143299	18143799	+

Transcript Sequence
>GWHTAAZE006032 ATGGGTTTCCCAGTTGGTTACACCGATCTCTTCCTCCCCAAACTATTCCTCTTCACTCTCACCATCCTTGGCCTTATCCGCAAACTCATTTCCGCCCTCTTCCGCACCCTCGGCCTCGGCGATTTCCTCGAGCCTGAAATCTCCTTCTCCACCCGGCTCGAAAGTCCAACAGAGTTCCGTTCCGTATCCGCCGCCCTGATCCGGGAGCTCCTCCCGGTCGTCATTTTCTCGGAGCTGGGCGTGGAGTCGCCGGAAAGTTGCGCCGTCTGCCTTTACGAATTCGACGGAGGGGACGAGATCCGGCGGCTGTCGAACTGCCGGCACATATTCCACAGGAGCTGCCTGGACCGTTGGATGGACCACGATCAGAAAACGTGCCCGCTTTGCAGGACCCCGTTTATTCCGGAGGATTTGCAGGAGAGTTTTAATGAGAGGCTATGGGCTGCTTCTGGTATCGGAGATTTTTACGATGACTACTCATCTCCCATTACTGGTTTGTAA

Network for GWHGAAZE006024

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	86	130	1.70E-13

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	65.508
	SRR3591706	second leaf	4.574
	SRR3591707	mature leaf	1.362
	SRR3591708	Shoot apex	15.864
	SRR3591709	Stem	66.520
	SRR3591710	White floral bud	72.180
	SRR3591711	White flower	36.773
	SRR3591712	Green floral bud	42.234
	SRR3591713	Yellow flower	42.061
SRP173429	SRR8316895	Juvenile bud stage	12.478
	SRR8316896	Juvenile bud stage	12.045
	SRR8316897	Juvenile bud stage	2.981
	SRR8316894	Third green stage	8.588
	SRR8316900	Third green stage	38.469
	SRR8316901	Third green stage	30.493
	SRR8316898	Complete white stage	34.907
	SRR8316899	Complete white stage	78.104
	SRR8316903	Complete white stage	66.510
	SRR8316902	Silver flowering stage	19.663
	SRR8316904	Silver flowering stage	28.094
	SRR8316905	Silver flowering stage	15.591
	SRR8316906	Gold flowering stage	38.755
	SRR8316907	Gold flowering stage	40.549
	SRR8316908	Gold flowering stage	31.969
SRP132670	SRR6706286	Control	64.567
	SRR6706287	Light intensity 50%	58.648
	SRR6706288	Light intensity 20%	63.716
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	24.310
	CNS0095593	Slightly white alabastrum(diploid) 2	68.129
	CNS0095594	Slightly white alabastrum(diploid) 3	27.775
	CNS0095595	Whole white alabastrum(diploid) 2	63.369
	CNS0095596	Whole white alabastrum(diploid) 3	61.019
	CNS0095597	Whole white alabastrum(diploid) 4	75.233
	CNS0095598	Silvery flower (diploied) 1	9.746
	CNS0095599	Silvery flower (diploied) 2	15.079
	CNS0095600	Silvery flower (diploied) 3	39.667
	CNS0095601	Golden flower (diploid) 1	10.045
	CNS0095602	Golden flower (diploid) 2	20.278
	CNS0095603	Golden flower (diploid) 3	24.316
	CNS0095604	Slightly white alabastrum(tetraploid) 1	41.898
	CNS0095605	Slightly white alabastrum(tetraploid) 2	34.767
	CNS0095606	Slightly white alabastrum(tetraploid) 3	71.862
	CNS0095607	Whole white alabastrum(tetraploid) 1	59.446
	CNS0095608	Whole white alabastrum(tetraploid) 2	72.201
	CNS0095609	Whole white alabastrum(tetraploid) 3	33.090
	CNS0095610	Silvery flower (tetraploid) 1	47.214
	CNS0095611	Silvery flower (tetraploid) 2	25.523
	CNS0095612	Silvery flower (tetraploid) 3	14.783
	CNS0095613	Golden flower (tetraploid) 1	50.849
	CNS0095614	Golden flower (tetraploid) 2	24.385
	CNS0095615	Golden flower (tetraploid) 3	51.712
CRA001975	CRR073297	Stem 1	49.799
	CRR073298	Stem 2	57.558
	CRR073299	Stem 3	45.539
	CRR073300	Leaf 1	142.717
	CRR073301	Leaf 2	179.326
	CRR073302	Leaf 3	127.293
	CRR073303	Juvenile bud 1	202.036
	CRR073304	Juvenile bud 2	122.995
	CRR073305	Juvenile bud 3	289.971
	CRR073306	Third green 1	40.327
	CRR073307	Third green 2	61.909
	CRR073308	Third green 3	40.825
	CRR073309	Second white 1	7.763
	CRR073310	Second white 2	10.294
	CRR073311	Second white 3	8.858
	CRR073312	Silver flowering 1	31.718
	CRR073313	Silver flowering 2	42.540
	CRR073314	Silver flowering 3	37.186
	CRR073315	Gold flowering 1	0.683
	CRR073316	Gold flowering 2	1.263
	CRR073317	Gold flowering 3	2.631
	CRR073318	Tawny withering 1	17.563
	CRR073319	Tawny withering 2	11.141
	CRR073320	Tawny withering 3	19.134