Gene detail

Detail information of GWHGAAZE006029

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010266050.1	4.85164E-56	PREDICTED: beta-adaptin-like protein B [Nelumbo nucifera]
Swissprot	tr\|Q9SUS3\|APBLB_ARATH	2E-54	Beta-adaptin-like protein B
trEMBL	tr\|M1AW83\|M1AW83_SOLTU	2E-56	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400031784}
TAIR10	AT4G11380.2	7E-48	Adaptin family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	18216743	18223184	+
GWHAAZE00000002	mRNA	18216743	18223184	+
GWHAAZE00000002	exon	18216743	18216796	+
GWHAAZE00000002	exon	18216870	18217025	+
GWHAAZE00000002	exon	18222574	18222846	+
GWHAAZE00000002	exon	18223161	18223184	+
GWHAAZE00000002	CDS	18216743	18216796	+
GWHAAZE00000002	CDS	18216870	18217025	+
GWHAAZE00000002	CDS	18222574	18222846	+
GWHAAZE00000002	CDS	18223161	18223184	+

Transcript Sequence
>GWHTAAZE006037 ATGATTCAATTCAACAAAAACACTTTTGGCCTTGGAGCTGCTGGGCTACTCCAAGTCCCACCATTGCCACCTGGGACATCCGCAAGAACTCATCTTCCCATAGTTTTGTTCCAGAATATTGCTCCAGGTCCCCTAAACACACTTTTGCAGGTTGCTGTAAAAAATAATCAACAGCCTGTGTGGTACTTCAACGATAAAGTCCCACTGCTGACGTGGAAGTCATTGCCGGATGCGAATGAGGGAGTTTCCAGGTATCGTAATAAACGGCGTGGAAGCAACACTAGACCGGTTAGCTGCATCAAATATGTTCTTCATTGCAAAGAGAAAGCACGCAAACCAAGAGGTATTGTATCTGTCAGCAAAGATCCCAGAGGAATCCCTTTTTTGATTGAACTCACAGCTGCTATTGGAGTACCTGGTCTCAAGTGTGCCATCAAAACTCCTAGCCCAGAAATGGCTCCTCTTTTCTTTGAATCCCTTGAGGCTCGTTTGGAACACATCTCATGA

Network for GWHGAAZE006029

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12392	AP1B1	Lysosome	map04142

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0016192	biological_process	vesicle-mediated transport
GO:0030117	cellular_component	membrane coat

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.173
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.343
	SRR3591709	Stem	0.325
	SRR3591710	White floral bud	0.210
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.619
	SRR3591713	Yellow flower	0.140
SRP173429	SRR8316895	Juvenile bud stage	0.008
	SRR8316896	Juvenile bud stage	1.158
	SRR8316897	Juvenile bud stage	0.600
	SRR8316894	Third green stage	0.227
	SRR8316900	Third green stage	1.096
	SRR8316901	Third green stage	1.710
	SRR8316898	Complete white stage	0.140
	SRR8316899	Complete white stage	0.322
	SRR8316903	Complete white stage	0.467
	SRR8316902	Silver flowering stage	0.368
	SRR8316904	Silver flowering stage	0.669
	SRR8316905	Silver flowering stage	0.440
	SRR8316906	Gold flowering stage	2.081
	SRR8316907	Gold flowering stage	2.013
	SRR8316908	Gold flowering stage	1.086
SRP132670	SRR6706286	Control	0.237
	SRR6706287	Light intensity 50%	0.134
	SRR6706288	Light intensity 20%	0.196
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.041
	CNS0095593	Slightly white alabastrum(diploid) 2	2.034
	CNS0095594	Slightly white alabastrum(diploid) 3	1.707
	CNS0095595	Whole white alabastrum(diploid) 2	1.682
	CNS0095596	Whole white alabastrum(diploid) 3	1.290
	CNS0095597	Whole white alabastrum(diploid) 4	1.672
	CNS0095598	Silvery flower (diploied) 1	0.384
	CNS0095599	Silvery flower (diploied) 2	0.068
	CNS0095600	Silvery flower (diploied) 3	0.588
	CNS0095601	Golden flower (diploid) 1	1.298
	CNS0095602	Golden flower (diploid) 2	0.571
	CNS0095603	Golden flower (diploid) 3	0.733
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.378
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.516
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.084
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.396
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.040
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.600
	CNS0095610	Silvery flower (tetraploid) 1	4.234
	CNS0095611	Silvery flower (tetraploid) 2	6.085
	CNS0095612	Silvery flower (tetraploid) 3	8.872
	CNS0095613	Golden flower (tetraploid) 1	8.968
	CNS0095614	Golden flower (tetraploid) 2	8.455
	CNS0095615	Golden flower (tetraploid) 3	10.946
CRA001975	CRR073297	Stem 1	0.285
	CRR073298	Stem 2	0.104
	CRR073299	Stem 3	0.134
	CRR073300	Leaf 1	0.538
	CRR073301	Leaf 2	0.431
	CRR073302	Leaf 3	0.051
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.191
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.030
	CRR073309	Second white 1	0.203
	CRR073310	Second white 2	1.621
	CRR073311	Second white 3	1.417
	CRR073312	Silver flowering 1	0.631
	CRR073313	Silver flowering 2	0.103
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000