Gene detail

Detail information of GWHGAAZE006119

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011030036.1	2.39501E-86	PREDICTED: dehydration-responsive element-binding protein 1A [Populus euphratica]
Swissprot	tr\|Q9FJ93\|DRE1D_ARATH	4E-67	Dehydration-responsive element-binding protein 1D
trEMBL	tr\|A9PH22\|A9PH22_POPTR	3E-86	Putative uncharacterized protein {ECO:0000313\|EMBL:ABK95675.1}
TAIR10	AT5G51990.1	7E-46	C-repeat-binding factor 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	19629354	19630016	+
GWHAAZE00000002	mRNA	19629354	19630016	+
GWHAAZE00000002	exon	19629354	19630016	+
GWHAAZE00000002	CDS	19629354	19630016	+

Transcript Sequence
>GWHTAAZE006127 ATGCCTACAGCCTATGCTCCTACCCGAATCCAATCGGGTCAAATTCCCAACAGGTCAACCCAATATACCTCGAGTCCTTCCTCTTACTCTGACAAGGAAGTTATATTGGCCTCGAGCCAGCCCAAAAAGCGGGCCGGACGGAAGAAGTTCAGTGAGACCCGACACCCCGTTTATAAGGGAGTGCGGAGGAAGAACTCGAACAGGTGGGTTTGTGAGCTAAGAGAGCCCAAGAAGAAGACGCGTATATGGCTCGGGACGTACCCAACCGCCGAGATGGCGGCCCGGGCACACGACGTGGCCGCACTGGCATTGCGGGGCCCGCAACCATGCCTCAACTTTGCCGATTCAGTGTGGCGCTTGCCCGTCCCTGCTACCAAGGAGGCCAAGGATATCCGGAAGGCGGCTACGGAAGCAGCAGAGGCGTTCCGGCCAGGGGACGAGATAGAGGAGGAATCCACCACCACTTCCGCCAGAGCTTTTGGCGGCAACGAGGCCGCAAGGGGTCATCATAAATCCTATATGGATGAGGAAGCAGTGTTTGATATGCCGGGATTAATTGCCAACATGGCGGAAGGGATGTTACTCTCTCCTCCTTGCTTAGCTGGCAGTTCCGATTGGGATGACGCGGAAAGTATTGCTGACCTGTCACTGTGGAGTTATTGA

Network for GWHGAAZE006119

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	56	106	5.70E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.797
	SRR3591706	second leaf	0.574
	SRR3591707	mature leaf	0.125
	SRR3591708	Shoot apex	8.493
	SRR3591709	Stem	2.507
	SRR3591710	White floral bud	10.699
	SRR3591711	White flower	8.458
	SRR3591712	Green floral bud	3.673
	SRR3591713	Yellow flower	2.980
SRP173429	SRR8316895	Juvenile bud stage	59.579
	SRR8316896	Juvenile bud stage	32.124
	SRR8316897	Juvenile bud stage	85.024
	SRR8316894	Third green stage	1.772
	SRR8316900	Third green stage	1.123
	SRR8316901	Third green stage	8.973
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	24.188
	SRR8316903	Complete white stage	0.147
	SRR8316902	Silver flowering stage	0.004
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.066
	SRR8316906	Gold flowering stage	0.140
	SRR8316907	Gold flowering stage	0.761
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.039
	SRR6706287	Light intensity 50%	0.166
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.025
	CNS0095593	Slightly white alabastrum(diploid) 2	50.038
	CNS0095594	Slightly white alabastrum(diploid) 3	57.445
	CNS0095595	Whole white alabastrum(diploid) 2	47.220
	CNS0095596	Whole white alabastrum(diploid) 3	2.939
	CNS0095597	Whole white alabastrum(diploid) 4	20.065
	CNS0095598	Silvery flower (diploied) 1	69.012
	CNS0095599	Silvery flower (diploied) 2	98.215
	CNS0095600	Silvery flower (diploied) 3	26.871
	CNS0095601	Golden flower (diploid) 1	69.968
	CNS0095602	Golden flower (diploid) 2	48.758
	CNS0095603	Golden flower (diploid) 3	47.918
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.017
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.021
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.061
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.487
	CNS0095611	Silvery flower (tetraploid) 2	0.072
	CNS0095612	Silvery flower (tetraploid) 3	1.551
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.200
CRA001975	CRR073297	Stem 1	11.267
	CRR073298	Stem 2	12.379
	CRR073299	Stem 3	9.731
	CRR073300	Leaf 1	15.794
	CRR073301	Leaf 2	21.357
	CRR073302	Leaf 3	8.432
	CRR073303	Juvenile bud 1	5.737
	CRR073304	Juvenile bud 2	25.041
	CRR073305	Juvenile bud 3	14.328
	CRR073306	Third green 1	1.553
	CRR073307	Third green 2	3.262
	CRR073308	Third green 3	2.426
	CRR073309	Second white 1	2.898
	CRR073310	Second white 2	1.779
	CRR073311	Second white 3	2.195
	CRR073312	Silver flowering 1	5.237
	CRR073313	Silver flowering 2	4.918
	CRR073314	Silver flowering 3	0.810
	CRR073315	Gold flowering 1	6.873
	CRR073316	Gold flowering 2	16.446
	CRR073317	Gold flowering 3	9.668
	CRR073318	Tawny withering 1	4.567
	CRR073319	Tawny withering 2	57.423
	CRR073320	Tawny withering 3	1.976