Gene detail

Detail information of GWHGAAZE006197

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009368886.1	4.57352E-28	PREDICTED: flavonoid 3',5'-hydroxylase 1-like [Pyrus x bretschneideri]
Swissprot	tr\|Q6YTF1\|C76M8_ORYSJ	2E-15	Oryzalexin D synthase
trEMBL	tr\|W9RYQ5\|W9RYQ5_9ROSA	7E-26	Flavonoid 3'-monooxygenase {ECO:0000313\|EMBL:EXC17882.1}
TAIR10	AT4G12300.1	5E-22	cytochrome P450, family 706, subfamily A, polypeptide 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	20929202	20929561	-
GWHAAZE00000002	mRNA	20929202	20929561	-
GWHAAZE00000002	exon	20929202	20929212	-
GWHAAZE00000002	exon	20929309	20929561	-
GWHAAZE00000002	CDS	20929309	20929561	-
GWHAAZE00000002	CDS	20929202	20929212	-

Transcript Sequence
>GWHTAAZE006205 ATGGGGAAAGGGATTTCTGTCGAAATGACTTCGACTTTTCTTCTGTTTGGATCAGGGAGAAGAATTTGTGCAGGTGTGGCAATGGCTGAGAGGATGGTGATGTTTTTGCTTGCTTCACTTTTACATTGTTTTAAGTGGAAATTGGGTGAAGGAGAGAAGATGGATCCGTCGGAAAAGTTTGGAATTGTGCTGCAAAAGAAGGTGCCTTTGGTTGCAATACCAGTACCAGGCTATCTGATCCAGAGCTATATCAAAGCAACATGA

Network for GWHGAAZE006197

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	12	67	4.20E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.331
	SRR3591706	second leaf	1.422
	SRR3591707	mature leaf	2.593
	SRR3591708	Shoot apex	1.162
	SRR3591709	Stem	3.846
	SRR3591710	White floral bud	2.475
	SRR3591711	White flower	1.711
	SRR3591712	Green floral bud	2.324
	SRR3591713	Yellow flower	1.340
SRP173429	SRR8316895	Juvenile bud stage	5.876
	SRR8316896	Juvenile bud stage	6.968
	SRR8316897	Juvenile bud stage	5.634
	SRR8316894	Third green stage	1.955
	SRR8316900	Third green stage	4.902
	SRR8316901	Third green stage	3.681
	SRR8316898	Complete white stage	0.220
	SRR8316899	Complete white stage	2.850
	SRR8316903	Complete white stage	1.691
	SRR8316902	Silver flowering stage	0.177
	SRR8316904	Silver flowering stage	1.740
	SRR8316905	Silver flowering stage	0.322
	SRR8316906	Gold flowering stage	0.451
	SRR8316907	Gold flowering stage	1.583
	SRR8316908	Gold flowering stage	1.122
SRP132670	SRR6706286	Control	0.601
	SRR6706287	Light intensity 50%	0.709
	SRR6706288	Light intensity 20%	0.872
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.079
	CNS0095593	Slightly white alabastrum(diploid) 2	5.850
	CNS0095594	Slightly white alabastrum(diploid) 3	6.758
	CNS0095595	Whole white alabastrum(diploid) 2	3.853
	CNS0095596	Whole white alabastrum(diploid) 3	3.237
	CNS0095597	Whole white alabastrum(diploid) 4	4.332
	CNS0095598	Silvery flower (diploied) 1	1.387
	CNS0095599	Silvery flower (diploied) 2	5.910
	CNS0095600	Silvery flower (diploied) 3	2.154
	CNS0095601	Golden flower (diploid) 1	6.149
	CNS0095602	Golden flower (diploid) 2	2.543
	CNS0095603	Golden flower (diploid) 3	3.885
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.888
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.758
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.823
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.444
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.439
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.621
	CNS0095610	Silvery flower (tetraploid) 1	3.006
	CNS0095611	Silvery flower (tetraploid) 2	2.102
	CNS0095612	Silvery flower (tetraploid) 3	1.580
	CNS0095613	Golden flower (tetraploid) 1	3.271
	CNS0095614	Golden flower (tetraploid) 2	4.577
	CNS0095615	Golden flower (tetraploid) 3	0.756
CRA001975	CRR073297	Stem 1	1.557
	CRR073298	Stem 2	3.179
	CRR073299	Stem 3	0.692
	CRR073300	Leaf 1	2.284
	CRR073301	Leaf 2	1.024
	CRR073302	Leaf 3	1.222
	CRR073303	Juvenile bud 1	0.172
	CRR073304	Juvenile bud 2	0.124
	CRR073305	Juvenile bud 3	0.472
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.017
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	3.681
	CRR073320	Tawny withering 3	0.204