Gene detail

Detail information of GWHGAAZE006274

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007039780.1	4.44831E-56	Integrase-type DNA-binding superfamily protein, putative [Theobroma cacao]
Swissprot	tr\|Q9ZQP3\|ERF38_ARATH	2E-46	Ethylene-responsive transcription factor ERF038
trEMBL	tr\|A0A061G3Z0\|A0A061G3Z0_THECC	2E-56	Integrase-type DNA-binding superfamily protein, putative {ECO:0000313\|EMBL:EOY24281.1}
TAIR10	AT5G11590.1	1E-33	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	22336485	22337069	-
GWHAAZE00000002	mRNA	22336485	22337069	-
GWHAAZE00000002	exon	22336485	22337069	-
GWHAAZE00000002	CDS	22336485	22337069	-

Transcript Sequence
>GWHTAAZE006282 ATGATCACGACATTCCACTCCCCTCCGGCCAAAAGCCCCACCGGAGTAGCACCACAAAAACCCACCAAACCATCAACCAGTGGACGAAAAAACGACAAAATCCCAATTTATCGCGGTGTACGAAAGAGAAGTTGGGGGAAATGGGTGTCCGAAATACGTGAGCCGAAGAAGAAATCTCGGATCTGGCTCGGAACCTTCGCAACTCCCGAGATGGCAGCTCGGGCCCACGATGTAGCTGCCATTACCATAAAGGGAAACTCCGCTTACCTCAACTTCCCCGAGCTGGCTCACGAGCTGCCACGCCCGGCTTCCACATGTCCCAAGGACATCCAAGCCGCCGCAGCGAAAGCTGCCCTTCTAGAAGATATCTCGAGACATGGAGTTGAATCCGAAGCTAGAGAGTTGTCGACTTCGCCACTAAGTAATGACGATGATGACCCCTTTTTTGACCTACCGGATCTTTTTCTTGATGTTAGTCACCGAGTTGATGAGTTTGGCTCGAATTTTCAGGCTCAGCTCACAGGAGCCGAGTTTGTCGACGGGGAGTTCTCGCCGGAGGACCCTTTCTTGTGGGGTTATAGCTAG

Network for GWHGAAZE006274

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	35	85	4.40E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.221
	SRR3591706	second leaf	19.769
	SRR3591707	mature leaf	25.255
	SRR3591708	Shoot apex	2.392
	SRR3591709	Stem	1.429
	SRR3591710	White floral bud	2.173
	SRR3591711	White flower	1.053
	SRR3591712	Green floral bud	1.144
	SRR3591713	Yellow flower	0.250
SRP173429	SRR8316895	Juvenile bud stage	0.297
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.312
	SRR8316894	Third green stage	0.526
	SRR8316900	Third green stage	0.697
	SRR8316901	Third green stage	0.207
	SRR8316898	Complete white stage	1.817
	SRR8316899	Complete white stage	3.400
	SRR8316903	Complete white stage	2.919
	SRR8316902	Silver flowering stage	0.819
	SRR8316904	Silver flowering stage	0.468
	SRR8316905	Silver flowering stage	0.288
	SRR8316906	Gold flowering stage	0.494
	SRR8316907	Gold flowering stage	1.083
	SRR8316908	Gold flowering stage	1.153
SRP132670	SRR6706286	Control	0.583
	SRR6706287	Light intensity 50%	1.360
	SRR6706288	Light intensity 20%	0.581
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.111
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.087
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.097
	CNS0095598	Silvery flower (diploied) 1	2.756
	CNS0095599	Silvery flower (diploied) 2	0.762
	CNS0095600	Silvery flower (diploied) 3	0.930
	CNS0095601	Golden flower (diploid) 1	2.676
	CNS0095602	Golden flower (diploid) 2	0.579
	CNS0095603	Golden flower (diploid) 3	0.374
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.299
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.361
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.203
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.385
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.018
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.477
	CNS0095610	Silvery flower (tetraploid) 1	0.234
	CNS0095611	Silvery flower (tetraploid) 2	2.051
	CNS0095612	Silvery flower (tetraploid) 3	1.304
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.390
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.091
	CRR073298	Stem 2	0.309
	CRR073299	Stem 3	1.000
	CRR073300	Leaf 1	0.206
	CRR073301	Leaf 2	0.988
	CRR073302	Leaf 3	0.204
	CRR073303	Juvenile bud 1	0.884
	CRR073304	Juvenile bud 2	1.494
	CRR073305	Juvenile bud 3	0.889
	CRR073306	Third green 1	1.762
	CRR073307	Third green 2	0.727
	CRR073308	Third green 3	2.020
	CRR073309	Second white 1	0.447
	CRR073310	Second white 2	0.204
	CRR073311	Second white 3	0.153
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.200
	CRR073315	Gold flowering 1	8.627
	CRR073316	Gold flowering 2	8.254
	CRR073317	Gold flowering 3	6.793
	CRR073318	Tawny withering 1	3.400
	CRR073319	Tawny withering 2	0.854
	CRR073320	Tawny withering 3	3.051