Gene detail

Detail information of GWHGAAZE006328

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004245986.1	8.6151E-102	PREDICTED: probable calcium-binding protein CML18 [Solanum lycopersicum]
Swissprot	tr\|Q9LQN4\|CML17_ARATH	9E-86	Probable calcium-binding protein CML17
trEMBL	tr\|M1B6P8\|M1B6P8_SOLTU	3E-102	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400038351}
TAIR10	AT3G03000.1	9E-59	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	23349612	23350106	+
GWHAAZE00000002	mRNA	23349612	23350106	+
GWHAAZE00000002	exon	23349612	23350106	+
GWHAAZE00000002	CDS	23349612	23350106	+

Transcript Sequence
>GWHTAAZE006336 ATGACCAGTAAGAAACCACCAGTTCAGCTTGACGATAAGCAGATATCCGAGCTCCGGGAGATTTTCCGGTCATTTGACCGTAACAATGATGGAAGCTTAACCCAGCTTGAGCTCGGCTCACTTTTAAGATCACTCGGCTTAAAGCCGAGCCCTGATCAGCTCGAAAGCCTAATTCAGAAGGCTGATACAAATAACAATGGCCTTATTGAATTCTCGGAGTTTGTGGGGCTGGTGGCGCCAGAGCTGCTGCCTGAGAAGTCTCCGTACACAGAGGAGCAGTTAAAGCAGCTCTTTAAGTTGTTTGATCGGGACGGGAACGGGTATATAACTGCGGCGGAGCTGGCTCACTCGATGGCGAAGCTAGGGCATGCGTTAACCGTGGAGGAGTTGACCGGGATGATCAAAGAGGCTGATACTGATGGTGATGGGAGGATAAGCTTTCAGGAATTTTCTCAGGCGATTACTTCAGCTGCATTTGATAATTCTTGGGCTTGA

Network for GWHGAAZE006328

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	16	77	3.60E-16
PF13499.7	EF-hand_7	91	154	8.60E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.437
	SRR3591706	second leaf	3.659
	SRR3591707	mature leaf	5.022
	SRR3591708	Shoot apex	0.952
	SRR3591709	Stem	0.773
	SRR3591710	White floral bud	3.598
	SRR3591711	White flower	8.523
	SRR3591712	Green floral bud	1.931
	SRR3591713	Yellow flower	9.237
SRP173429	SRR8316895	Juvenile bud stage	3.877
	SRR8316896	Juvenile bud stage	7.956
	SRR8316897	Juvenile bud stage	2.539
	SRR8316894	Third green stage	0.942
	SRR8316900	Third green stage	1.221
	SRR8316901	Third green stage	2.172
	SRR8316898	Complete white stage	4.001
	SRR8316899	Complete white stage	0.214
	SRR8316903	Complete white stage	3.889
	SRR8316902	Silver flowering stage	4.542
	SRR8316904	Silver flowering stage	7.000
	SRR8316905	Silver flowering stage	3.695
	SRR8316906	Gold flowering stage	13.015
	SRR8316907	Gold flowering stage	11.997
	SRR8316908	Gold flowering stage	7.304
SRP132670	SRR6706286	Control	1.205
	SRR6706287	Light intensity 50%	1.028
	SRR6706288	Light intensity 20%	0.438
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.475
	CNS0095593	Slightly white alabastrum(diploid) 2	9.948
	CNS0095594	Slightly white alabastrum(diploid) 3	16.090
	CNS0095595	Whole white alabastrum(diploid) 2	3.661
	CNS0095596	Whole white alabastrum(diploid) 3	2.988
	CNS0095597	Whole white alabastrum(diploid) 4	0.963
	CNS0095598	Silvery flower (diploied) 1	4.856
	CNS0095599	Silvery flower (diploied) 2	2.876
	CNS0095600	Silvery flower (diploied) 3	14.957
	CNS0095601	Golden flower (diploid) 1	5.959
	CNS0095602	Golden flower (diploid) 2	7.373
	CNS0095603	Golden flower (diploid) 3	9.856
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.032
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.224
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.197
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.570
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.467
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.233
	CNS0095610	Silvery flower (tetraploid) 1	2.191
	CNS0095611	Silvery flower (tetraploid) 2	2.530
	CNS0095612	Silvery flower (tetraploid) 3	14.088
	CNS0095613	Golden flower (tetraploid) 1	7.362
	CNS0095614	Golden flower (tetraploid) 2	4.363
	CNS0095615	Golden flower (tetraploid) 3	4.995
CRA001975	CRR073297	Stem 1	10.218
	CRR073298	Stem 2	6.314
	CRR073299	Stem 3	6.204
	CRR073300	Leaf 1	1.279
	CRR073301	Leaf 2	1.471
	CRR073302	Leaf 3	1.309
	CRR073303	Juvenile bud 1	0.452
	CRR073304	Juvenile bud 2	0.717
	CRR073305	Juvenile bud 3	0.830
	CRR073306	Third green 1	15.198
	CRR073307	Third green 2	21.356
	CRR073308	Third green 3	17.489
	CRR073309	Second white 1	21.740
	CRR073310	Second white 2	26.906
	CRR073311	Second white 3	25.182
	CRR073312	Silver flowering 1	23.637
	CRR073313	Silver flowering 2	17.742
	CRR073314	Silver flowering 3	12.090
	CRR073315	Gold flowering 1	8.411
	CRR073316	Gold flowering 2	4.437
	CRR073317	Gold flowering 3	2.950
	CRR073318	Tawny withering 1	0.276
	CRR073319	Tawny withering 2	1.841
	CRR073320	Tawny withering 3	0.675