Gene detail

Detail information of GWHGAAZE006444

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011002367.1	6.50773E-59	PREDICTED: acyl carrier protein 3, mitochondrial-like [Populus euphratica]
Swissprot	tr\|Q9FGJ4\|ACPM3_ARATH	3E-38	Acyl carrier protein 3, mitochondrial (Precursor)
trEMBL	tr\|B9HCD1\|B9HCD1_POPTR	4E-59	Acyl carrier protein {ECO:0000256\|RuleBase:RU000722}
TAIR10	AT5G47630.2	7E-31	mitochondrial acyl carrier protein 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	25689784	25690769	-
GWHAAZE00000002	mRNA	25689784	25690769	-
GWHAAZE00000002	exon	25690530	25690769	-
GWHAAZE00000002	exon	25689784	25690145	-
GWHAAZE00000002	five_prime_UTR	25690728	25690769	-
GWHAAZE00000002	CDS	25690530	25690727	-
GWHAAZE00000002	CDS	25689954	25690145	-
GWHAAZE00000002	three_prime_UTR	25689784	25689953	-

Transcript Sequence
>GWHTAAZE006452 TGACCTGTTCTGAAAGTTTAGTAATCCTCAGATCTCCTGAACATGCAAAGCCTAAGAAACTCTGTTTTGAGATACGTGAGGATTAGGGTCTCTACAAGGGAAATGTTCCTTGCAAGTGATGCAAGTGTAGTCAACAGAGTCTGCCGACCACTATGCACGTCCGCTGGCACAAGCCCCGATCAGATAATGGCTCGAGTACTTGGATTGGTCAAGAAATTTGACAAGATTGATGCCGCTAAGGTTACTGAAAAGGCTGATTTCCAGAAGGACTTGTGCCTCGACAGTTTGGATAGGGTGGAGCTTGTTATGGCTTTTGAACAAGAATTCTCCATTGAAATTCCTGAGGAGAAAGCAGACAAGCTTAAATGCTGTGCCGATGTTGCTAAATACATCATATCTGGAGATGAGCAGAAGATTACTGGAAATTCTTGATTGGTTTCTGGAACTTTTATTGATTCAGTTGTTTAAAGTTTTGGATTAAAATACAATCGAGGGTCACTTTTATTGCTGTCTCCGTTAGGATATTTACAGTATATGTTGTTTTCTTCAACTCTTAACTTTCTTTGGAATAACATTCATATTGAGTCTTTTTTGTTGCTGCA

Network for GWHGAAZE006444

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00550.26	PP-binding	51	117	1.00E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03955	NDUFAB1	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0006633	biological_process	fatty acid biosynthetic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.826
	SRR3591706	second leaf	1.826
	SRR3591707	mature leaf	3.205
	SRR3591708	Shoot apex	8.860
	SRR3591709	Stem	6.570
	SRR3591710	White floral bud	2.705
	SRR3591711	White flower	4.670
	SRR3591712	Green floral bud	8.112
	SRR3591713	Yellow flower	2.837
SRP173429	SRR8316895	Juvenile bud stage	6.209
	SRR8316896	Juvenile bud stage	10.618
	SRR8316897	Juvenile bud stage	3.405
	SRR8316894	Third green stage	2.852
	SRR8316900	Third green stage	6.367
	SRR8316901	Third green stage	6.579
	SRR8316898	Complete white stage	0.379
	SRR8316899	Complete white stage	3.913
	SRR8316903	Complete white stage	1.631
	SRR8316902	Silver flowering stage	0.502
	SRR8316904	Silver flowering stage	0.332
	SRR8316905	Silver flowering stage	0.084
	SRR8316906	Gold flowering stage	1.202
	SRR8316907	Gold flowering stage	0.886
	SRR8316908	Gold flowering stage	2.955
SRP132670	SRR6706286	Control	3.531
	SRR6706287	Light intensity 50%	2.628
	SRR6706288	Light intensity 20%	4.562
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.245
	CNS0095593	Slightly white alabastrum(diploid) 2	9.636
	CNS0095594	Slightly white alabastrum(diploid) 3	13.190
	CNS0095595	Whole white alabastrum(diploid) 2	7.046
	CNS0095596	Whole white alabastrum(diploid) 3	4.775
	CNS0095597	Whole white alabastrum(diploid) 4	7.356
	CNS0095598	Silvery flower (diploied) 1	4.853
	CNS0095599	Silvery flower (diploied) 2	4.686
	CNS0095600	Silvery flower (diploied) 3	2.169
	CNS0095601	Golden flower (diploid) 1	4.821
	CNS0095602	Golden flower (diploid) 2	4.076
	CNS0095603	Golden flower (diploid) 3	2.830
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.189
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.378
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.174
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.839
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.106
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.189
	CNS0095610	Silvery flower (tetraploid) 1	2.022
	CNS0095611	Silvery flower (tetraploid) 2	2.401
	CNS0095612	Silvery flower (tetraploid) 3	2.669
	CNS0095613	Golden flower (tetraploid) 1	1.184
	CNS0095614	Golden flower (tetraploid) 2	1.021
	CNS0095615	Golden flower (tetraploid) 3	0.225
CRA001975	CRR073297	Stem 1	7.297
	CRR073298	Stem 2	6.520
	CRR073299	Stem 3	8.892
	CRR073300	Leaf 1	5.250
	CRR073301	Leaf 2	7.070
	CRR073302	Leaf 3	8.472
	CRR073303	Juvenile bud 1	6.622
	CRR073304	Juvenile bud 2	3.814
	CRR073305	Juvenile bud 3	6.100
	CRR073306	Third green 1	1.042
	CRR073307	Third green 2	0.062
	CRR073308	Third green 3	0.293
	CRR073309	Second white 1	0.177
	CRR073310	Second white 2	1.406
	CRR073311	Second white 3	0.313
	CRR073312	Silver flowering 1	1.338
	CRR073313	Silver flowering 2	0.200
	CRR073314	Silver flowering 3	0.285
	CRR073315	Gold flowering 1	16.722
	CRR073316	Gold flowering 2	12.869
	CRR073317	Gold flowering 3	9.397
	CRR073318	Tawny withering 1	11.775
	CRR073319	Tawny withering 2	12.016
	CRR073320	Tawny withering 3	9.227