Gene detail

Detail information of GWHGAAZE006554

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006452110.1	1.5942E-125	hypothetical protein CICLE_v10009497mg [Citrus clementina]
Swissprot	tr\|Q6NQE2\|FQRL1_ARATH	6E-124	Probable NAD(P)H dehydrogenase (quinone) FQR1-like 1 {ECO:0000305}
trEMBL	tr\|A0A067GG13\|A0A067GG13_CITSI	6E-126	Uncharacterized protein {ECO:0000313\|EMBL:KDO74382.1}
TAIR10	AT4G27270.1	1E-89	Quinone reductase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	27663821	27665117	-
GWHAAZE00000002	mRNA	27663821	27665117	-
GWHAAZE00000002	exon	27663821	27664052	-
GWHAAZE00000002	exon	27664541	27664803	-
GWHAAZE00000002	exon	27665013	27665117	-
GWHAAZE00000002	CDS	27665013	27665117	-
GWHAAZE00000002	CDS	27664541	27664803	-
GWHAAZE00000002	CDS	27663821	27664052	-

Transcript Sequence
>GWHTAAZE006562 ATGTATTACAGTTACTACTCCATGTATGGACATGTTGAGAAGTTGGCACAAGAGATAAAGAAAGGAGCTGCATCTATTGAAGGAGTTGAAGCAACACTATGGCAGGTGCCAGAGACACTACCAGATGAGGTACTTGGGAAAATGTACGCGGCGCCAAAGAGTGACGCGCCGATTATTACCCCTAATGAGCTAGCTGAGGCTGACGGGCTTATATTCGGTTTCCCAACTAGATTTGGAATGATGGCGGCTCAATTCAAAGCATTTTTTGATTCGACCGGTGGTCTGTGGAAGACCCAGGGTCTGGCTGGCAAGCCCGCTGGCATCTTTTATAGCACTGGATCCCAAGGAGGTGGTCAAGAAACAACCGCATTGACGGCCATTACTCAACTTGTACATCATGGTATGATATTTGTACCCATTGGATACACATTTGGAGCCGGCATGTCTGAGATGGAGAAGATCAAGGGCGGGAGCCCATATGGTGCTGGTACTTATGCTGGAGACGGCTCGAGACAGCCTTCTGAGCTTGAACTCGAACAAGCTTTCCACCAGGGGAAGCACATTGCCGCCATTGCAAAGAAGCTCAAAGGAACTGCTTGA

Network for GWHGAAZE006554

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03358.16	FMN_red	13	140	5.80E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03809	wrbA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Ubiquinone and other terpenoid-quinone biosynthesis	map00130

Gene Ontology

GO term	Ontology	Name
GO:0016491	molecular_function	oxidoreductase activity
GO:0003955	molecular_function	NAD(P)H dehydrogenase (quinone) activity
GO:0010181	molecular_function	FMN binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.764
	SRR3591706	second leaf	2.975
	SRR3591707	mature leaf	3.379
	SRR3591708	Shoot apex	6.196
	SRR3591709	Stem	20.283
	SRR3591710	White floral bud	5.373
	SRR3591711	White flower	38.029
	SRR3591712	Green floral bud	12.573
	SRR3591713	Yellow flower	182.769
SRP173429	SRR8316895	Juvenile bud stage	10.076
	SRR8316896	Juvenile bud stage	23.546
	SRR8316897	Juvenile bud stage	8.798
	SRR8316894	Third green stage	6.621
	SRR8316900	Third green stage	12.802
	SRR8316901	Third green stage	15.215
	SRR8316898	Complete white stage	3.436
	SRR8316899	Complete white stage	8.808
	SRR8316903	Complete white stage	5.862
	SRR8316902	Silver flowering stage	7.077
	SRR8316904	Silver flowering stage	11.239
	SRR8316905	Silver flowering stage	5.008
	SRR8316906	Gold flowering stage	51.026
	SRR8316907	Gold flowering stage	27.208
	SRR8316908	Gold flowering stage	78.851
SRP132670	SRR6706286	Control	17.283
	SRR6706287	Light intensity 50%	11.514
	SRR6706288	Light intensity 20%	10.555
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.536
	CNS0095593	Slightly white alabastrum(diploid) 2	11.291
	CNS0095594	Slightly white alabastrum(diploid) 3	27.557
	CNS0095595	Whole white alabastrum(diploid) 2	8.270
	CNS0095596	Whole white alabastrum(diploid) 3	7.946
	CNS0095597	Whole white alabastrum(diploid) 4	10.687
	CNS0095598	Silvery flower (diploied) 1	10.650
	CNS0095599	Silvery flower (diploied) 2	16.062
	CNS0095600	Silvery flower (diploied) 3	7.601
	CNS0095601	Golden flower (diploid) 1	5.739
	CNS0095602	Golden flower (diploid) 2	19.405
	CNS0095603	Golden flower (diploid) 3	24.055
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.566
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.685
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.294
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.314
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.209
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.626
	CNS0095610	Silvery flower (tetraploid) 1	3.282
	CNS0095611	Silvery flower (tetraploid) 2	1.240
	CNS0095612	Silvery flower (tetraploid) 3	5.333
	CNS0095613	Golden flower (tetraploid) 1	19.011
	CNS0095614	Golden flower (tetraploid) 2	11.357
	CNS0095615	Golden flower (tetraploid) 3	10.069
CRA001975	CRR073297	Stem 1	12.115
	CRR073298	Stem 2	11.827
	CRR073299	Stem 3	25.162
	CRR073300	Leaf 1	4.577
	CRR073301	Leaf 2	6.634
	CRR073302	Leaf 3	5.552
	CRR073303	Juvenile bud 1	1.837
	CRR073304	Juvenile bud 2	2.652
	CRR073305	Juvenile bud 3	2.272
	CRR073306	Third green 1	3.615
	CRR073307	Third green 2	9.406
	CRR073308	Third green 3	5.051
	CRR073309	Second white 1	11.650
	CRR073310	Second white 2	19.968
	CRR073311	Second white 3	10.323
	CRR073312	Silver flowering 1	36.002
	CRR073313	Silver flowering 2	31.124
	CRR073314	Silver flowering 3	46.220
	CRR073315	Gold flowering 1	17.315
	CRR073316	Gold flowering 2	19.190
	CRR073317	Gold flowering 3	14.559
	CRR073318	Tawny withering 1	184.289
	CRR073319	Tawny withering 2	154.914
	CRR073320	Tawny withering 3	110.458