Gene detail

Detail information of GWHGAAZE006555

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009624079.1	1.76121E-36	PREDICTED: putative G-type lectin S-receptor-like serine/threonine-protein kinase At1g61610 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9ZR08\|Y4230_ARATH	4E-35	G-type lectin S-receptor-like serine/threonine-protein kinase At4g03230 (Precursor)
trEMBL	tr\|M1B353\|M1B353_SOLTU	4E-39	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400036026}
TAIR10	AT4G03230.1	1E-30	S-locus lectin protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	27681169	27681393	-
GWHAAZE00000002	mRNA	27681169	27681393	-
GWHAAZE00000002	exon	27681169	27681393	-
GWHAAZE00000002	CDS	27681169	27681393	-

Transcript Sequence
>GWHTAAZE006563 ATGTTGGATTGGAAAAAGCGCCATGAAATTATTGTGGGAATTGGTCGAGGAATGCTTTATCTTCATCAAGACTCAAGGTTAAGAATTATTCATCGAGATTTGAAAGCAAGCAACATTCTTCTAGACCAAGAGTTGGATCCCAAAATCTCTGACTTTGGAACAGCAAGAATATTTGGAGGGAATCAAAATGAAGCAAATACTAACAGAGTTGTCGGAACATTGTAA

Network for GWHGAAZE006555

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	6	73	1.90E-15

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.709
	SRR3591706	second leaf	3.005
	SRR3591707	mature leaf	1.357
	SRR3591708	Shoot apex	10.534
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.586
	SRR3591711	White flower	4.769
	SRR3591712	Green floral bud	18.908
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.694
	SRR8316896	Juvenile bud stage	4.721
	SRR8316897	Juvenile bud stage	2.303
	SRR8316894	Third green stage	2.685
	SRR8316900	Third green stage	15.799
	SRR8316901	Third green stage	13.786
	SRR8316898	Complete white stage	0.179
	SRR8316899	Complete white stage	6.036
	SRR8316903	Complete white stage	2.274
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.013
SRP132670	SRR6706286	Control	1.069
	SRR6706287	Light intensity 50%	1.479
	SRR6706288	Light intensity 20%	1.948
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.226
	CNS0095593	Slightly white alabastrum(diploid) 2	7.570
	CNS0095594	Slightly white alabastrum(diploid) 3	8.574
	CNS0095595	Whole white alabastrum(diploid) 2	13.064
	CNS0095596	Whole white alabastrum(diploid) 3	13.364
	CNS0095597	Whole white alabastrum(diploid) 4	19.024
	CNS0095598	Silvery flower (diploied) 1	7.303
	CNS0095599	Silvery flower (diploied) 2	1.281
	CNS0095600	Silvery flower (diploied) 3	0.864
	CNS0095601	Golden flower (diploid) 1	1.951
	CNS0095602	Golden flower (diploid) 2	0.962
	CNS0095603	Golden flower (diploid) 3	1.408
	CNS0095604	Slightly white alabastrum(tetraploid) 1	28.731
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.796
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.147
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.919
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.966
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.066
	CNS0095610	Silvery flower (tetraploid) 1	0.815
	CNS0095611	Silvery flower (tetraploid) 2	2.416
	CNS0095612	Silvery flower (tetraploid) 3	0.319
	CNS0095613	Golden flower (tetraploid) 1	0.602
	CNS0095614	Golden flower (tetraploid) 2	1.091
	CNS0095615	Golden flower (tetraploid) 3	0.686
CRA001975	CRR073297	Stem 1	1.990
	CRR073298	Stem 2	1.528
	CRR073299	Stem 3	1.236
	CRR073300	Leaf 1	2.999
	CRR073301	Leaf 2	2.660
	CRR073302	Leaf 3	1.215
	CRR073303	Juvenile bud 1	1.822
	CRR073304	Juvenile bud 2	0.435
	CRR073305	Juvenile bud 3	2.029
	CRR073306	Third green 1	0.562
	CRR073307	Third green 2	0.124
	CRR073308	Third green 3	0.057
	CRR073309	Second white 1	0.717
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.433
	CRR073313	Silver flowering 2	0.001
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.549
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.689
	CRR073319	Tawny withering 2	1.662
	CRR073320	Tawny withering 3	1.298