Gene detail

Detail information of GWHGAAZE006632

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002305784.1	1.83623E-38	hypothetical protein POPTR_0004s04590g [Populus trichocarpa]
Swissprot	tr\|Q84TE9\|DOF53_ARATH	9E-37	Dof zinc finger protein DOF5.3
trEMBL	tr\|B9H2S7\|B9H2S7_POPTR	7E-39	Uncharacterized protein {ECO:0000313\|EMBL:EEE86295.1}
TAIR10	AT5G60200.1	2E-26	TARGET OF MONOPTEROS 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	29052530	29052970	-
GWHAAZE00000002	mRNA	29052530	29052970	-
GWHAAZE00000002	exon	29052530	29052970	-
GWHAAZE00000002	CDS	29052530	29052970	-

Transcript Sequence
>GWHTAAZE006640 CAGCAGCAGCAGCAGCAGCAGCAGCTGCAATCTCCTCAGCAACAGGTACAGTCTCATCAGCAGCAAGTGCCGCCTCAGCAACAGCCTCAGAAATGCCCGCGTTGCGAGTCAGTCAACACCAAGTTCTGCTACTACAACAACTACAGCCTTTCTCAGCCTCGCTACTTCTGCAAGACTTGCCGAAGGTACTGGACCCAAGGTGGAACCCTAAGGAACGTCCCAGTAGGTGGCGGTTGTCGTAAGGGAAAGCGTGCCAAGCCTTCCTCCTCGTCATCTGGGGAGATCTCGAGATCCTTACCACCTCCACCACCATCTGAAGGACAGGCTTTCAGTGTCCTTCCAATGAATTTAGGTAATAATTTGGGTTTGCCACCAGTTAATCTGACGACAACCCCAAATTATTATACTAGTGGTGGTGGGTTTTTATCTTCTTTGGCGGCT

Network for GWHGAAZE006632

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	28	84	3.30E-33

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.847
	SRR3591706	second leaf	4.766
	SRR3591707	mature leaf	2.612
	SRR3591708	Shoot apex	6.769
	SRR3591709	Stem	12.666
	SRR3591710	White floral bud	16.254
	SRR3591711	White flower	6.640
	SRR3591712	Green floral bud	11.379
	SRR3591713	Yellow flower	2.530
SRP173429	SRR8316895	Juvenile bud stage	3.761
	SRR8316896	Juvenile bud stage	3.118
	SRR8316897	Juvenile bud stage	0.984
	SRR8316894	Third green stage	2.441
	SRR8316900	Third green stage	5.969
	SRR8316901	Third green stage	7.396
	SRR8316898	Complete white stage	6.657
	SRR8316899	Complete white stage	7.807
	SRR8316903	Complete white stage	11.471
	SRR8316902	Silver flowering stage	5.098
	SRR8316904	Silver flowering stage	3.382
	SRR8316905	Silver flowering stage	4.019
	SRR8316906	Gold flowering stage	3.824
	SRR8316907	Gold flowering stage	4.385
	SRR8316908	Gold flowering stage	3.940
SRP132670	SRR6706286	Control	3.726
	SRR6706287	Light intensity 50%	3.603
	SRR6706288	Light intensity 20%	3.212
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.933
	CNS0095593	Slightly white alabastrum(diploid) 2	5.244
	CNS0095594	Slightly white alabastrum(diploid) 3	2.941
	CNS0095595	Whole white alabastrum(diploid) 2	2.097
	CNS0095596	Whole white alabastrum(diploid) 3	4.343
	CNS0095597	Whole white alabastrum(diploid) 4	4.074
	CNS0095598	Silvery flower (diploied) 1	1.675
	CNS0095599	Silvery flower (diploied) 2	2.823
	CNS0095600	Silvery flower (diploied) 3	4.870
	CNS0095601	Golden flower (diploid) 1	0.634
	CNS0095602	Golden flower (diploid) 2	3.110
	CNS0095603	Golden flower (diploid) 3	1.909
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.038
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.970
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.166
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.848
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.402
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.145
	CNS0095610	Silvery flower (tetraploid) 1	6.768
	CNS0095611	Silvery flower (tetraploid) 2	4.038
	CNS0095612	Silvery flower (tetraploid) 3	7.618
	CNS0095613	Golden flower (tetraploid) 1	0.694
	CNS0095614	Golden flower (tetraploid) 2	2.578
	CNS0095615	Golden flower (tetraploid) 3	2.292
CRA001975	CRR073297	Stem 1	7.222
	CRR073298	Stem 2	4.311
	CRR073299	Stem 3	10.906
	CRR073300	Leaf 1	8.116
	CRR073301	Leaf 2	7.587
	CRR073302	Leaf 3	9.939
	CRR073303	Juvenile bud 1	10.734
	CRR073304	Juvenile bud 2	5.354
	CRR073305	Juvenile bud 3	14.297
	CRR073306	Third green 1	12.829
	CRR073307	Third green 2	18.400
	CRR073308	Third green 3	11.076
	CRR073309	Second white 1	2.859
	CRR073310	Second white 2	3.202
	CRR073311	Second white 3	1.684
	CRR073312	Silver flowering 1	1.671
	CRR073313	Silver flowering 2	1.249
	CRR073314	Silver flowering 3	2.393
	CRR073315	Gold flowering 1	4.415
	CRR073316	Gold flowering 2	4.175
	CRR073317	Gold flowering 3	4.155
	CRR073318	Tawny withering 1	23.477
	CRR073319	Tawny withering 2	15.791
	CRR073320	Tawny withering 3	26.171