Gene detail

Detail information of GWHGAAZE006674

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010279105.1	2.15827E-71	PREDICTED: probable inactive dual specificity protein phosphatase-like At4g18593 [Nelumbo nucifera]
Swissprot	tr\|Q570P7\|DUSL1_ARATH	3E-53	Probable inactive dual specificity protein phosphatase-like At4g18593
trEMBL	tr\|K4B8R7\|K4B8R7_SOLLC	9E-67	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc02g076900.2.1}
TAIR10	AT4G18593.1	1E-42	dual specificity protein phosphatase-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	29797359	29798600	+
GWHAAZE00000002	mRNA	29797359	29798600	+
GWHAAZE00000002	exon	29797359	29797593	+
GWHAAZE00000002	exon	29798446	29798600	+
GWHAAZE00000002	CDS	29797359	29797593	+
GWHAAZE00000002	CDS	29798446	29798600	+

Transcript Sequence
>GWHTAAZE006682 ATGGAAGCACCTAATAACTCTGATTCAGTATCTGATCCGATTCCTCAAGTCATTTACCGTTGCAAGAAATGCCGTAGAATCGTTGCGACACAAGAGCACATAACTACCCACGAGCGAGGAGAAGGACAAAAATGCTTTAAATGGAAAAAAAGAAGTGGTGACCCATGGGAAATGGATAAAAAACCACCCGAGTGTTCCTCCATTTTCGTCGAGCCCATGAAGTGGATGGAATCAGTACAAGAAGGTTGCGTGGGAGATAAGCTCCAATGCATGGGTTGCAAAGCGCGCTTGGGTTCTTTCAATTGGGCAGGTATGCAGTGCAACTGCGGAGCATGGGTTAATCCTGCGTTTCAGCTACACAAAAGCAGATTAGATGAATGCCATCTATGA

Network for GWHGAAZE006674

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	23.012
	SRR3591706	second leaf	16.109
	SRR3591707	mature leaf	17.696
	SRR3591708	Shoot apex	23.805
	SRR3591709	Stem	19.596
	SRR3591710	White floral bud	22.340
	SRR3591711	White flower	25.562
	SRR3591712	Green floral bud	35.664
	SRR3591713	Yellow flower	27.415
SRP173429	SRR8316895	Juvenile bud stage	21.162
	SRR8316896	Juvenile bud stage	23.633
	SRR8316897	Juvenile bud stage	13.363
	SRR8316894	Third green stage	13.606
	SRR8316900	Third green stage	40.438
	SRR8316901	Third green stage	33.836
	SRR8316898	Complete white stage	12.397
	SRR8316899	Complete white stage	25.462
	SRR8316903	Complete white stage	14.805
	SRR8316902	Silver flowering stage	9.414
	SRR8316904	Silver flowering stage	11.225
	SRR8316905	Silver flowering stage	6.428
	SRR8316906	Gold flowering stage	20.038
	SRR8316907	Gold flowering stage	17.473
	SRR8316908	Gold flowering stage	22.792
SRP132670	SRR6706286	Control	38.256
	SRR6706287	Light intensity 50%	39.682
	SRR6706288	Light intensity 20%	41.867
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	43.539
	CNS0095593	Slightly white alabastrum(diploid) 2	40.615
	CNS0095594	Slightly white alabastrum(diploid) 3	45.484
	CNS0095595	Whole white alabastrum(diploid) 2	44.351
	CNS0095596	Whole white alabastrum(diploid) 3	47.467
	CNS0095597	Whole white alabastrum(diploid) 4	38.505
	CNS0095598	Silvery flower (diploied) 1	23.431
	CNS0095599	Silvery flower (diploied) 2	22.529
	CNS0095600	Silvery flower (diploied) 3	21.812
	CNS0095601	Golden flower (diploid) 1	21.330
	CNS0095602	Golden flower (diploid) 2	21.935
	CNS0095603	Golden flower (diploid) 3	17.612
	CNS0095604	Slightly white alabastrum(tetraploid) 1	39.736
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.152
	CNS0095606	Slightly white alabastrum(tetraploid) 3	31.039
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.920
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.950
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.622
	CNS0095610	Silvery flower (tetraploid) 1	29.411
	CNS0095611	Silvery flower (tetraploid) 2	22.359
	CNS0095612	Silvery flower (tetraploid) 3	20.839
	CNS0095613	Golden flower (tetraploid) 1	21.325
	CNS0095614	Golden flower (tetraploid) 2	31.064
	CNS0095615	Golden flower (tetraploid) 3	21.274
CRA001975	CRR073297	Stem 1	22.875
	CRR073298	Stem 2	19.367
	CRR073299	Stem 3	20.646
	CRR073300	Leaf 1	22.675
	CRR073301	Leaf 2	20.872
	CRR073302	Leaf 3	18.933
	CRR073303	Juvenile bud 1	22.688
	CRR073304	Juvenile bud 2	14.865
	CRR073305	Juvenile bud 3	15.042
	CRR073306	Third green 1	12.571
	CRR073307	Third green 2	9.936
	CRR073308	Third green 3	8.086
	CRR073309	Second white 1	9.903
	CRR073310	Second white 2	14.336
	CRR073311	Second white 3	7.608
	CRR073312	Silver flowering 1	4.816
	CRR073313	Silver flowering 2	5.477
	CRR073314	Silver flowering 3	8.655
	CRR073315	Gold flowering 1	18.084
	CRR073316	Gold flowering 2	13.735
	CRR073317	Gold flowering 3	10.222
	CRR073318	Tawny withering 1	24.462
	CRR073319	Tawny withering 2	22.278
	CRR073320	Tawny withering 3	12.059