Gene detail

Detail information of GWHGAAZE006941

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002305773.2	3.11261E-93	Syntaxin 61 family protein [Populus trichocarpa]
Swissprot	tr\|Q946Y7\|SYP61_ARATH	5E-73	Syntaxin-61
trEMBL	tr\|B9H2P0\|B9H2P0_POPTR	1E-93	Syntaxin 61 family protein {ECO:0000313\|EMBL:EEE86284.2}
TAIR10	AT1G28490.1	5E-59	syntaxin of plants 61

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	34609579	34615565	-
GWHAAZE00000002	mRNA	34609579	34615565	-
GWHAAZE00000002	exon	34609579	34609669	-
GWHAAZE00000002	exon	34610688	34610884	-
GWHAAZE00000002	exon	34612778	34612895	-
GWHAAZE00000002	exon	34613813	34613955	-
GWHAAZE00000002	exon	34615386	34615565	-
GWHAAZE00000002	CDS	34615386	34615565	-
GWHAAZE00000002	CDS	34613813	34613955	-
GWHAAZE00000002	CDS	34612778	34612895	-
GWHAAZE00000002	CDS	34610688	34610884	-
GWHAAZE00000002	CDS	34609579	34609669	-

Transcript Sequence
>GWHTAAZE006949 ATGGGTGGCTCATCCTCACCAGATCTCTATCGTCCTGTCATCAATCGGACTCTCATCAATTTCACTCTCATCAATCTTACTATCATCAATATCATCAATAACACTATCACCAATAACATTAGAAAGCTTTCTCATATTAAGAAGAGTCTCCTTAATGCTACGATAAAGGATCTGAACAAGATTGATAAGTTGCAGTCGAGTTTTCACCAATGGGAGCGCACACTTTCAGGTAGTCAAGAGCAATTGCATTTGACAAAGGAGCTCTTAGCGGGTTGTGAGAGCATTGAGTGGCAGGTACTAGCTCGAACTGTTCACTTGCAAATGAAGGTAGATGAACTGGACAAGGCAATTTCTGTAGCAGCTAGAGACCCCTCTTGGTATGGCATTGATGAAGTGGAGCTTGAGAAACGAAGGAGATGGACCAGCACCGCTCGTGCTCAGGTGGGTAATATGAAGAAAGCGGTTGTGGCTGGTAAGGAGGTGAATGGTACAAGCACTTCTAATGCAAGTGGAATGCGCAGAGAATTAATGAGAATGCCAAATTCTCATCAGACTGACAGATCCAATCACTATGTTTCTCAAGACAATAATGATGATTTTATATCATCCGAGTCAGACAGGCAGTTGCTTCTTATAAGGCAACAAGATGAAGAGCTGGATGAGCTTAGTGCAAGTGTAGAAAGAATCGGAGGTGTGGGTCTTACCATACATGAAGAACTTCTTGCCCAG

Network for GWHGAAZE006941

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF09177.12	Syntaxin-6_N	59	152	1.20E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08500	SYP6	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0048193	biological_process	Golgi vesicle transport
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.170
	SRR3591706	second leaf	28.407
	SRR3591707	mature leaf	16.947
	SRR3591708	Shoot apex	32.236
	SRR3591709	Stem	40.816
	SRR3591710	White floral bud	50.849
	SRR3591711	White flower	41.008
	SRR3591712	Green floral bud	48.531
	SRR3591713	Yellow flower	28.900
SRP173429	SRR8316895	Juvenile bud stage	28.360
	SRR8316896	Juvenile bud stage	41.970
	SRR8316897	Juvenile bud stage	24.216
	SRR8316894	Third green stage	17.857
	SRR8316900	Third green stage	58.103
	SRR8316901	Third green stage	46.784
	SRR8316898	Complete white stage	21.836
	SRR8316899	Complete white stage	61.287
	SRR8316903	Complete white stage	31.614
	SRR8316902	Silver flowering stage	22.485
	SRR8316904	Silver flowering stage	25.848
	SRR8316905	Silver flowering stage	13.034
	SRR8316906	Gold flowering stage	38.860
	SRR8316907	Gold flowering stage	35.559
	SRR8316908	Gold flowering stage	35.623
SRP132670	SRR6706286	Control	47.961
	SRR6706287	Light intensity 50%	46.136
	SRR6706288	Light intensity 20%	49.918
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	39.261
	CNS0095593	Slightly white alabastrum(diploid) 2	44.425
	CNS0095594	Slightly white alabastrum(diploid) 3	44.596
	CNS0095595	Whole white alabastrum(diploid) 2	43.542
	CNS0095596	Whole white alabastrum(diploid) 3	49.141
	CNS0095597	Whole white alabastrum(diploid) 4	40.066
	CNS0095598	Silvery flower (diploied) 1	39.587
	CNS0095599	Silvery flower (diploied) 2	41.497
	CNS0095600	Silvery flower (diploied) 3	43.956
	CNS0095601	Golden flower (diploid) 1	31.403
	CNS0095602	Golden flower (diploid) 2	31.173
	CNS0095603	Golden flower (diploid) 3	35.080
	CNS0095604	Slightly white alabastrum(tetraploid) 1	42.935
	CNS0095605	Slightly white alabastrum(tetraploid) 2	37.233
	CNS0095606	Slightly white alabastrum(tetraploid) 3	56.375
	CNS0095607	Whole white alabastrum(tetraploid) 1	33.842
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.079
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.696
	CNS0095610	Silvery flower (tetraploid) 1	38.620
	CNS0095611	Silvery flower (tetraploid) 2	29.891
	CNS0095612	Silvery flower (tetraploid) 3	28.362
	CNS0095613	Golden flower (tetraploid) 1	21.891
	CNS0095614	Golden flower (tetraploid) 2	33.903
	CNS0095615	Golden flower (tetraploid) 3	15.992
CRA001975	CRR073297	Stem 1	35.747
	CRR073298	Stem 2	32.318
	CRR073299	Stem 3	31.790
	CRR073300	Leaf 1	34.168
	CRR073301	Leaf 2	37.278
	CRR073302	Leaf 3	41.961
	CRR073303	Juvenile bud 1	33.593
	CRR073304	Juvenile bud 2	25.508
	CRR073305	Juvenile bud 3	24.475
	CRR073306	Third green 1	14.743
	CRR073307	Third green 2	27.208
	CRR073308	Third green 3	18.989
	CRR073309	Second white 1	14.116
	CRR073310	Second white 2	13.049
	CRR073311	Second white 3	8.888
	CRR073312	Silver flowering 1	8.461
	CRR073313	Silver flowering 2	7.430
	CRR073314	Silver flowering 3	6.537
	CRR073315	Gold flowering 1	13.236
	CRR073316	Gold flowering 2	16.905
	CRR073317	Gold flowering 3	13.852
	CRR073318	Tawny withering 1	34.295
	CRR073319	Tawny withering 2	21.979
	CRR073320	Tawny withering 3	33.083