Gene detail

Detail information of GWHGAAZE006959

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009773130.1	5.70182E-34	PREDICTED: cytochrome c6, chloroplastic [Nicotiana sylvestris]
Swissprot	tr\|Q93VA3\|CYC6_ARATH	7E-34	Cytochrome c6, chloroplastic (Precursor)
trEMBL	tr\|M1ANR8\|M1ANR8_SOLTU	6E-33	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400026828}
TAIR10	AT5G45040.1	7E-28	Cytochrome c

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	35170940	35171992	-
GWHAAZE00000002	mRNA	35170940	35171992	-
GWHAAZE00000002	exon	35170940	35171062	-
GWHAAZE00000002	exon	35171150	35171213	-
GWHAAZE00000002	exon	35171440	35171471	-
GWHAAZE00000002	exon	35171540	35171637	-
GWHAAZE00000002	exon	35171899	35171992	-
GWHAAZE00000002	CDS	35171899	35171992	-
GWHAAZE00000002	CDS	35171540	35171637	-
GWHAAZE00000002	CDS	35171440	35171471	-
GWHAAZE00000002	CDS	35171150	35171213	-
GWHAAZE00000002	CDS	35170940	35171062	-

Transcript Sequence
>GWHTAAZE006967 ATGTTAATCGATACCGTGTTGATATTGATGGGGTTCTTTGGGGACCTTTCCCCTTCTAGTTTACTAGGGGGAAAGGAAAACGTAATTGTGAAAACGTCATTCGGGCAAGCAATAGAAGCACAAAGAGGAGCCGCGTTGTTTAATCGAGCTTGCATTGGATGTCATGTTGCAGGCGGAAACATAATACAACCAGGTGCAACACTCTTCTTTAAAGATCTAGAAAGAAATGGAGCTGACACTGAAAATGAGATATATCGAATAACATACTACGGCAAAGGAAGAATGCCCGGTTTGGCCAAAATTGTACACCGAGGGGTCAATGCACATTCGGAGCTCGTCTACAGGAAGACGAGATTAAAGTTTTGGCCGAGTTTGTCAAGTCTCAGGCCGATCAAGGTTGGCCCAATATAG

Network for GWHGAAZE006959

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13442.7	Cytochrome_CBB3	40	100	2.50E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08906	petJ	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009055	molecular_function	electron transfer activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.870
	SRR3591706	second leaf	21.404
	SRR3591707	mature leaf	8.566
	SRR3591708	Shoot apex	16.372
	SRR3591709	Stem	1.869
	SRR3591710	White floral bud	0.583
	SRR3591711	White flower	0.777
	SRR3591712	Green floral bud	3.283
	SRR3591713	Yellow flower	0.275
SRP173429	SRR8316895	Juvenile bud stage	7.091
	SRR8316896	Juvenile bud stage	5.639
	SRR8316897	Juvenile bud stage	3.824
	SRR8316894	Third green stage	1.900
	SRR8316900	Third green stage	7.172
	SRR8316901	Third green stage	5.273
	SRR8316898	Complete white stage	0.492
	SRR8316899	Complete white stage	1.889
	SRR8316903	Complete white stage	1.148
	SRR8316902	Silver flowering stage	0.254
	SRR8316904	Silver flowering stage	0.333
	SRR8316905	Silver flowering stage	0.083
	SRR8316906	Gold flowering stage	0.142
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.380
SRP132670	SRR6706286	Control	6.379
	SRR6706287	Light intensity 50%	5.050
	SRR6706288	Light intensity 20%	5.878
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.143
	CNS0095593	Slightly white alabastrum(diploid) 2	10.630
	CNS0095594	Slightly white alabastrum(diploid) 3	4.889
	CNS0095595	Whole white alabastrum(diploid) 2	7.843
	CNS0095596	Whole white alabastrum(diploid) 3	6.906
	CNS0095597	Whole white alabastrum(diploid) 4	6.741
	CNS0095598	Silvery flower (diploied) 1	10.274
	CNS0095599	Silvery flower (diploied) 2	8.099
	CNS0095600	Silvery flower (diploied) 3	2.052
	CNS0095601	Golden flower (diploid) 1	6.944
	CNS0095602	Golden flower (diploid) 2	3.765
	CNS0095603	Golden flower (diploid) 3	2.872
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.252
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.957
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.393
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.342
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.735
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.876
	CNS0095610	Silvery flower (tetraploid) 1	0.106
	CNS0095611	Silvery flower (tetraploid) 2	1.206
	CNS0095612	Silvery flower (tetraploid) 3	0.551
	CNS0095613	Golden flower (tetraploid) 1	0.075
	CNS0095614	Golden flower (tetraploid) 2	0.164
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	10.748
	CRR073298	Stem 2	10.175
	CRR073299	Stem 3	12.003
	CRR073300	Leaf 1	6.474
	CRR073301	Leaf 2	8.874
	CRR073302	Leaf 3	4.572
	CRR073303	Juvenile bud 1	1.376
	CRR073304	Juvenile bud 2	1.361
	CRR073305	Juvenile bud 3	2.418
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.260
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.046
	CRR073311	Second white 3	0.390
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	55.096
	CRR073316	Gold flowering 2	65.754
	CRR073317	Gold flowering 3	29.999
	CRR073318	Tawny withering 1	6.876
	CRR073319	Tawny withering 2	7.764
	CRR073320	Tawny withering 3	5.648