Gene detail

Detail information of GWHGAAZE006981

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG15354.1	1.14533E-87	LOB domain-containing 4 -like protein [Gossypium arboreum]
Swissprot	tr\|Q9SHE9\|LBD4_ARATH	4E-66	LOB domain-containing protein 4
trEMBL	tr\|I1L0C8\|I1L0C8_SOYBN	1E-82	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA09G02510.1}
TAIR10	AT1G31320.1	4E-45	LOB domain-containing protein 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	35598197	35601974	+
GWHAAZE00000002	mRNA	35598197	35601974	+
GWHAAZE00000002	exon	35598197	35598385	+
GWHAAZE00000002	exon	35601660	35601974	+
GWHAAZE00000002	CDS	35598197	35598385	+
GWHAAZE00000002	CDS	35601660	35601974	+

Transcript Sequence
>GWHTAAZE006989 CTAAGCAGCATGAAGGAGAGTGGTACTAGGAAGCAAGGTACAAGCTCACCATGCGCAGCGTGCAAGTTGCTAAGGCGGAGATGTGGTGAGGATTGTGTGTTTGCTCCTTATTTTCCTGCAGATGAGCCCCATAAGTTTGCCAACGTCCACAGGGTCTTTGGTGCTAGCAATGTCAACAAAATGTTACAGGAATTGCCGGTGGACCAACGAGGAGATGCAGTGAGCAGCATGGTTTATGAAGCCGATGCTAGAATTCGAGACCCAGTGTATGGGTGTGTTGGGGCCATATCATCTCTGCAGCACCAGGTTGATGTTCTTCAAGCCCAATTGGCTCAGGCTCAGGCCGAGGTGGTGCACCTAAGGGTGCGCCAGGGTGTACCAATTAGCCCAACAAATAGTGGCTCACCCTCATTTATGAATTCACAGTCACACCCGATGCCCATTTTTGACATGGATATGATGATGGAGCAGGACAACTTTAGAGAGTCAATGTGGCCATGTTAG

Network for GWHGAAZE006981

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03195.15	LOB	17	114	2.70E-43

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	LOB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.078
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.253
	SRR3591709	Stem	6.478
	SRR3591710	White floral bud	1.895
	SRR3591711	White flower	4.190
	SRR3591712	Green floral bud	0.823
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.245
	SRR8316894	Third green stage	0.059
	SRR8316900	Third green stage	0.619
	SRR8316901	Third green stage	1.166
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.474
	SRR8316903	Complete white stage	0.162
	SRR8316902	Silver flowering stage	0.003
	SRR8316904	Silver flowering stage	0.214
	SRR8316905	Silver flowering stage	0.110
	SRR8316906	Gold flowering stage	0.386
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.219
SRP132670	SRR6706286	Control	5.898
	SRR6706287	Light intensity 50%	3.040
	SRR6706288	Light intensity 20%	2.349
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.113
	CNS0095593	Slightly white alabastrum(diploid) 2	0.503
	CNS0095594	Slightly white alabastrum(diploid) 3	0.876
	CNS0095595	Whole white alabastrum(diploid) 2	0.992
	CNS0095596	Whole white alabastrum(diploid) 3	1.587
	CNS0095597	Whole white alabastrum(diploid) 4	0.718
	CNS0095598	Silvery flower (diploied) 1	2.598
	CNS0095599	Silvery flower (diploied) 2	0.352
	CNS0095600	Silvery flower (diploied) 3	0.737
	CNS0095601	Golden flower (diploid) 1	4.676
	CNS0095602	Golden flower (diploid) 2	1.411
	CNS0095603	Golden flower (diploid) 3	2.117
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.022
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.940
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.087
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.786
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.008
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.255
	CNS0095610	Silvery flower (tetraploid) 1	0.999
	CNS0095611	Silvery flower (tetraploid) 2	2.265
	CNS0095612	Silvery flower (tetraploid) 3	0.766
	CNS0095613	Golden flower (tetraploid) 1	0.063
	CNS0095614	Golden flower (tetraploid) 2	0.133
	CNS0095615	Golden flower (tetraploid) 3	0.650
CRA001975	CRR073297	Stem 1	1.188
	CRR073298	Stem 2	1.330
	CRR073299	Stem 3	0.838
	CRR073300	Leaf 1	2.196
	CRR073301	Leaf 2	1.264
	CRR073302	Leaf 3	4.223
	CRR073303	Juvenile bud 1	1.632
	CRR073304	Juvenile bud 2	1.902
	CRR073305	Juvenile bud 3	0.561
	CRR073306	Third green 1	0.153
	CRR073307	Third green 2	0.079
	CRR073308	Third green 3	0.078
	CRR073309	Second white 1	0.154
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.403
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.514