Gene detail

Detail information of GWHGAAZE007022

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006492822.1	2.7657E-101	PREDICTED: 60S ribosomal protein L21-2-like [Citrus sinensis]
Swissprot	tr\|Q9FDZ9\|RL212_ARATH	1E-98	60S ribosomal protein L21-2
trEMBL	tr\|A0A067G5K5\|A0A067G5K5_CITSI	1E-101	Uncharacterized protein {ECO:0000313\|EMBL:KDO70857.1}
TAIR10	AT1G57660.1	8E-78	Translation protein SH3-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	36468080	36469922	+
GWHAAZE00000002	mRNA	36468080	36469922	+
GWHAAZE00000002	exon	36468080	36468343	+
GWHAAZE00000002	exon	36469665	36469922	+
GWHAAZE00000002	CDS	36468080	36468343	+
GWHAAZE00000002	CDS	36469665	36469922	+

Transcript Sequence
>GWHTAAZE007030 ATGCCGGCCGGACATGGATTGCGGTCCCGGACTAGGGATTTATTCTCTCGAGGCTTCAGGAAGAAAGGTACCATCAATCTATCCACTTACCTGAGGACCTATCATGTCGGAGATTATGTCGATATCAAGGTTAATGGCGCCATTCACAAAGGTATGCCCCACAAGTTCTACCATGGCCGCACTGGTCAGGTCTGGAATGTCACCAAGAGAGCCATTGGTGTTGAGATGAACAAGCAGGTAATGAATTTCTCTTGTTTTCCTGTGGTCGGAAACAGGATCATCAAGAAAAGGATCCACGTGCGTGTGGAGCATGTGATGCCCTCAAGGTGCACAGAGGAGTTCAAGTTGAGGAAGAAGAACAACGACAAGCTTAAGGCTGAGGCCAAGGCAAGAGGCGAGATTGTCAGTACCAAAAGGCAACCACTTGGACCCAAACCAGGTTTCATGGTCGAAGGGCATACGTTGGAGACTGTAACTCCTATTCCCTATGATGTGGTCAACGATCTCAAGGGAGGGTATTGA

Network for GWHGAAZE007022

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01157.19	Ribosomal_L21e	1	110	2.50E-39

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02889	RP-L21e, RPL21	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	404.043
	SRR3591706	second leaf	162.033
	SRR3591707	mature leaf	85.264
	SRR3591708	Shoot apex	476.010
	SRR3591709	Stem	191.946
	SRR3591710	White floral bud	165.185
	SRR3591711	White flower	216.819
	SRR3591712	Green floral bud	324.992
	SRR3591713	Yellow flower	166.283
SRP173429	SRR8316895	Juvenile bud stage	178.995
	SRR8316896	Juvenile bud stage	242.012
	SRR8316897	Juvenile bud stage	128.054
	SRR8316894	Third green stage	111.000
	SRR8316900	Third green stage	331.681
	SRR8316901	Third green stage	308.927
	SRR8316898	Complete white stage	65.230
	SRR8316899	Complete white stage	225.415
	SRR8316903	Complete white stage	86.012
	SRR8316902	Silver flowering stage	76.006
	SRR8316904	Silver flowering stage	65.773
	SRR8316905	Silver flowering stage	35.457
	SRR8316906	Gold flowering stage	120.430
	SRR8316907	Gold flowering stage	131.822
	SRR8316908	Gold flowering stage	153.096
SRP132670	SRR6706286	Control	399.624
	SRR6706287	Light intensity 50%	401.480
	SRR6706288	Light intensity 20%	458.698
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	265.593
	CNS0095593	Slightly white alabastrum(diploid) 2	322.368
	CNS0095594	Slightly white alabastrum(diploid) 3	223.817
	CNS0095595	Whole white alabastrum(diploid) 2	201.483
	CNS0095596	Whole white alabastrum(diploid) 3	290.061
	CNS0095597	Whole white alabastrum(diploid) 4	168.485
	CNS0095598	Silvery flower (diploied) 1	116.600
	CNS0095599	Silvery flower (diploied) 2	118.216
	CNS0095600	Silvery flower (diploied) 3	117.779
	CNS0095601	Golden flower (diploid) 1	93.577
	CNS0095602	Golden flower (diploid) 2	91.157
	CNS0095603	Golden flower (diploid) 3	96.177
	CNS0095604	Slightly white alabastrum(tetraploid) 1	247.874
	CNS0095605	Slightly white alabastrum(tetraploid) 2	246.391
	CNS0095606	Slightly white alabastrum(tetraploid) 3	376.394
	CNS0095607	Whole white alabastrum(tetraploid) 1	130.863
	CNS0095608	Whole white alabastrum(tetraploid) 2	117.979
	CNS0095609	Whole white alabastrum(tetraploid) 3	248.252
	CNS0095610	Silvery flower (tetraploid) 1	120.798
	CNS0095611	Silvery flower (tetraploid) 2	103.331
	CNS0095612	Silvery flower (tetraploid) 3	118.023
	CNS0095613	Golden flower (tetraploid) 1	82.865
	CNS0095614	Golden flower (tetraploid) 2	105.205
	CNS0095615	Golden flower (tetraploid) 3	70.723
CRA001975	CRR073297	Stem 1	284.842
	CRR073298	Stem 2	277.634
	CRR073299	Stem 3	316.002
	CRR073300	Leaf 1	268.817
	CRR073301	Leaf 2	289.560
	CRR073302	Leaf 3	363.614
	CRR073303	Juvenile bud 1	289.923
	CRR073304	Juvenile bud 2	216.409
	CRR073305	Juvenile bud 3	221.892
	CRR073306	Third green 1	99.381
	CRR073307	Third green 2	96.551
	CRR073308	Third green 3	98.739
	CRR073309	Second white 1	102.471
	CRR073310	Second white 2	90.010
	CRR073311	Second white 3	59.186
	CRR073312	Silver flowering 1	106.415
	CRR073313	Silver flowering 2	153.921
	CRR073314	Silver flowering 3	119.921
	CRR073315	Gold flowering 1	102.889
	CRR073316	Gold flowering 2	110.375
	CRR073317	Gold flowering 3	111.017
	CRR073318	Tawny withering 1	240.496
	CRR073319	Tawny withering 2	194.185
	CRR073320	Tawny withering 3	253.702