Gene detail

Detail information of GWHGAAZE007158

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI30075.3	1.94786E-56	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q9SS31\|CML36_ARATH	1E-36	Probable calcium-binding protein CML36
trEMBL	tr\|A0A022PSZ4\|A0A022PSZ4_ERYGU	2E-50	Uncharacterized protein {ECO:0000313\|EMBL:EYU18659.1}
TAIR10	AT3G10190.1	6E-30	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	39354906	39355553	+
GWHAAZE00000002	mRNA	39354906	39355553	+
GWHAAZE00000002	exon	39354906	39355087	+
GWHAAZE00000002	exon	39355229	39355553	+
GWHAAZE00000002	CDS	39354906	39355087	+
GWHAAZE00000002	CDS	39355229	39355553	+

Transcript Sequence
>GWHTAAZE007166 ATGAAACTCCTCACCAACATCAACCCCAAGAAAATCTTCCAGTCCAAAAAATCCCGGTCCGTCTCTCGGTCCAATCCCTCTTCTTTCTCCTCCTCAGATTCATCATCCGACGGCTCAGATCTCTCCAAGCCCAAATCCAACGGCTTAGCCACGCCCACCAGCGTTCTCCCGGCCCAACCGGACGAGGAGGAGGTAGACTTGATGCTGAGCGAGGTGGATAGGGAAAATGATGGGTCGATAAGCCTTGAGAAGCTTGGCTCAATAGGCTCGGCTTTCGAGCCCGCTCCTTGCCAAGCCGAGCTGTTAGAGACTTTTAACTTTTTTGATACGGACCATGACGGAAAGATAACGGCTGAGGAGCTGTTAAATGTGTTTAGTTCGATAGGGGATGGGCGGTGCTCGTTAGAGGACTGCCGGCGCATGATATCAGGGGTGGATAAGAACGGAGATGGGTTTGTGTGCTTCGAGGACTTTGCTCGTATGATGGAGCCTCATCTCTATACTTGA

Network for GWHGAAZE007158

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13833.7	EF-hand_8	60	83	0.00014
PF13499.7	EF-hand_7	100	162	3.20E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	309.594
	SRR3591706	second leaf	161.747
	SRR3591707	mature leaf	457.908
	SRR3591708	Shoot apex	228.947
	SRR3591709	Stem	383.816
	SRR3591710	White floral bud	271.471
	SRR3591711	White flower	238.691
	SRR3591712	Green floral bud	270.203
	SRR3591713	Yellow flower	52.827
SRP173429	SRR8316895	Juvenile bud stage	140.917
	SRR8316896	Juvenile bud stage	138.138
	SRR8316897	Juvenile bud stage	93.726
	SRR8316894	Third green stage	56.650
	SRR8316900	Third green stage	172.335
	SRR8316901	Third green stage	212.970
	SRR8316898	Complete white stage	45.049
	SRR8316899	Complete white stage	371.567
	SRR8316903	Complete white stage	91.102
	SRR8316902	Silver flowering stage	58.130
	SRR8316904	Silver flowering stage	49.554
	SRR8316905	Silver flowering stage	33.061
	SRR8316906	Gold flowering stage	109.147
	SRR8316907	Gold flowering stage	113.714
	SRR8316908	Gold flowering stage	160.783
SRP132670	SRR6706286	Control	342.984
	SRR6706287	Light intensity 50%	352.982
	SRR6706288	Light intensity 20%	343.777
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	185.146
	CNS0095593	Slightly white alabastrum(diploid) 2	192.813
	CNS0095594	Slightly white alabastrum(diploid) 3	174.134
	CNS0095595	Whole white alabastrum(diploid) 2	115.803
	CNS0095596	Whole white alabastrum(diploid) 3	89.339
	CNS0095597	Whole white alabastrum(diploid) 4	116.705
	CNS0095598	Silvery flower (diploied) 1	337.289
	CNS0095599	Silvery flower (diploied) 2	214.873
	CNS0095600	Silvery flower (diploied) 3	157.608
	CNS0095601	Golden flower (diploid) 1	255.401
	CNS0095602	Golden flower (diploid) 2	178.642
	CNS0095603	Golden flower (diploid) 3	181.632
	CNS0095604	Slightly white alabastrum(tetraploid) 1	110.726
	CNS0095605	Slightly white alabastrum(tetraploid) 2	83.661
	CNS0095606	Slightly white alabastrum(tetraploid) 3	204.246
	CNS0095607	Whole white alabastrum(tetraploid) 1	97.394
	CNS0095608	Whole white alabastrum(tetraploid) 2	54.702
	CNS0095609	Whole white alabastrum(tetraploid) 3	65.301
	CNS0095610	Silvery flower (tetraploid) 1	49.255
	CNS0095611	Silvery flower (tetraploid) 2	43.340
	CNS0095612	Silvery flower (tetraploid) 3	37.908
	CNS0095613	Golden flower (tetraploid) 1	61.526
	CNS0095614	Golden flower (tetraploid) 2	59.534
	CNS0095615	Golden flower (tetraploid) 3	25.120
CRA001975	CRR073297	Stem 1	228.451
	CRR073298	Stem 2	230.580
	CRR073299	Stem 3	320.926
	CRR073300	Leaf 1	223.788
	CRR073301	Leaf 2	265.981
	CRR073302	Leaf 3	312.386
	CRR073303	Juvenile bud 1	252.895
	CRR073304	Juvenile bud 2	303.027
	CRR073305	Juvenile bud 3	358.617
	CRR073306	Third green 1	118.565
	CRR073307	Third green 2	129.901
	CRR073308	Third green 3	149.539
	CRR073309	Second white 1	222.780
	CRR073310	Second white 2	48.732
	CRR073311	Second white 3	15.769
	CRR073312	Silver flowering 1	40.267
	CRR073313	Silver flowering 2	81.049
	CRR073314	Silver flowering 3	52.789
	CRR073315	Gold flowering 1	527.702
	CRR073316	Gold flowering 2	483.776
	CRR073317	Gold flowering 3	626.083
	CRR073318	Tawny withering 1	357.664
	CRR073319	Tawny withering 2	406.275
	CRR073320	Tawny withering 3	403.553