Gene detail

Detail information of GWHGAAZE007168

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003632734.1	2.25E-110	PREDICTED: DNA-directed RNA polymerase V subunit 5A [Vitis vinifera]
Swissprot	tr\|Q9M1J2\|RPE5A_ARATH	2E-97	DNA-directed RNA polymerase V subunit 5A
trEMBL	tr\|F6HLQ4\|F6HLQ4_VITVI	8E-111	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB55310.1}
TAIR10	AT3G57080.1	3E-71	Eukaryotic rpb5 RNA polymerase subunit family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	39553210	39563873	-
GWHAAZE00000002	mRNA	39553210	39563873	-
GWHAAZE00000002	exon	39563649	39563873	-
GWHAAZE00000002	exon	39559666	39559842	-
GWHAAZE00000002	exon	39555621	39555734	-
GWHAAZE00000002	exon	39553210	39553335	-
GWHAAZE00000002	CDS	39563649	39563873	-
GWHAAZE00000002	CDS	39559666	39559842	-
GWHAAZE00000002	CDS	39555621	39555734	-
GWHAAZE00000002	CDS	39553210	39553335	-

Transcript Sequence
>GWHTAAZE007176 ATGCCGAGGTGTTTGAGCAGCTACGCGGACCAAGGTAGCACTGAGAGTCACCGTTACTACCTCTCCCGCCGAACCATGCTTGAGTTGCTCAAGGACCGGGGCTATTCCATACCTGATTCCGAAATCAATATATCCCTCGAAGAATTTCGCAATATTCACGGCCAAAAACCCGATATCGAACGCCTTCGTATCTCCGCTTCTCTCGAATCGAACCCTTCTAAAAAGGTTCTAGTTGTTTACTGTGGGACTGGTATGGTAAAAGTAAATATCATCCGTAACATCGCGGCTCAGATAATGAACAAGGAAACTTTAAGTAAGCTGATAATTGTAGTACAGAACAAAATTACAAACCAAGCGATGAAAGCGACGGAACTGTTTTCGTTTAAAGTTGAAATTTTCGAGATCACCGACTTACTTGTTAACATCACGAAGCATGTGTTGAAGCCAAAGCATCGTGTACTGACTGATGGTGAGAAGAAAAAGCTCTTAAAGAAGTACAACTTGGAAGAAAAACAGCTACCTCGAATGACACTAAACGATGCTATCTCCAAATACTATGGACTGCAGAAAGGGCAGGTGGTGGAAATCAGTTACAACGGTGAAGCTACTGGTTTACATGTCACTTATCGATGTGTTTGGTGA

Network for GWHGAAZE007168

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03871.15	RNA_pol_Rpb5_N	14	97	1.20E-20
PF01191.20	RNA_pol_Rpb5_C	140	212	6.30E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03013	RPB5, POLR2E	RNA polymerase	map03020
K03013	RPB5, POLR2E	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.028
	SRR3591706	second leaf	17.259
	SRR3591707	mature leaf	14.143
	SRR3591708	Shoot apex	62.218
	SRR3591709	Stem	26.806
	SRR3591710	White floral bud	15.008
	SRR3591711	White flower	13.523
	SRR3591712	Green floral bud	21.431
	SRR3591713	Yellow flower	6.478
SRP173429	SRR8316895	Juvenile bud stage	35.756
	SRR8316896	Juvenile bud stage	49.457
	SRR8316897	Juvenile bud stage	21.751
	SRR8316894	Third green stage	16.991
	SRR8316900	Third green stage	39.694
	SRR8316901	Third green stage	34.605
	SRR8316898	Complete white stage	6.354
	SRR8316899	Complete white stage	55.504
	SRR8316903	Complete white stage	14.732
	SRR8316902	Silver flowering stage	4.401
	SRR8316904	Silver flowering stage	4.818
	SRR8316905	Silver flowering stage	2.498
	SRR8316906	Gold flowering stage	7.194
	SRR8316907	Gold flowering stage	7.721
	SRR8316908	Gold flowering stage	9.780
SRP132670	SRR6706286	Control	24.680
	SRR6706287	Light intensity 50%	26.672
	SRR6706288	Light intensity 20%	26.572
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	58.353
	CNS0095593	Slightly white alabastrum(diploid) 2	53.845
	CNS0095594	Slightly white alabastrum(diploid) 3	51.634
	CNS0095595	Whole white alabastrum(diploid) 2	36.283
	CNS0095596	Whole white alabastrum(diploid) 3	33.809
	CNS0095597	Whole white alabastrum(diploid) 4	26.941
	CNS0095598	Silvery flower (diploied) 1	31.085
	CNS0095599	Silvery flower (diploied) 2	37.248
	CNS0095600	Silvery flower (diploied) 3	19.607
	CNS0095601	Golden flower (diploid) 1	42.524
	CNS0095602	Golden flower (diploid) 2	30.648
	CNS0095603	Golden flower (diploid) 3	23.113
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.568
	CNS0095605	Slightly white alabastrum(tetraploid) 2	41.661
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.043
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.047
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.611
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.744
	CNS0095610	Silvery flower (tetraploid) 1	13.774
	CNS0095611	Silvery flower (tetraploid) 2	20.548
	CNS0095612	Silvery flower (tetraploid) 3	11.661
	CNS0095613	Golden flower (tetraploid) 1	7.808
	CNS0095614	Golden flower (tetraploid) 2	14.098
	CNS0095615	Golden flower (tetraploid) 3	4.486
CRA001975	CRR073297	Stem 1	32.291
	CRR073298	Stem 2	26.130
	CRR073299	Stem 3	31.116
	CRR073300	Leaf 1	21.258
	CRR073301	Leaf 2	23.040
	CRR073302	Leaf 3	16.059
	CRR073303	Juvenile bud 1	16.175
	CRR073304	Juvenile bud 2	10.660
	CRR073305	Juvenile bud 3	14.777
	CRR073306	Third green 1	2.033
	CRR073307	Third green 2	1.912
	CRR073308	Third green 3	2.198
	CRR073309	Second white 1	3.154
	CRR073310	Second white 2	1.801
	CRR073311	Second white 3	1.544
	CRR073312	Silver flowering 1	0.232
	CRR073313	Silver flowering 2	0.478
	CRR073314	Silver flowering 3	1.708
	CRR073315	Gold flowering 1	22.466
	CRR073316	Gold flowering 2	24.950
	CRR073317	Gold flowering 3	14.358
	CRR073318	Tawny withering 1	25.592
	CRR073319	Tawny withering 2	26.989
	CRR073320	Tawny withering 3	27.343