Gene detail

Detail information of GWHGAAZE007182

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010554769.1	1.49466E-51	PREDICTED: vacuolar amino acid transporter 1 [Tarenaya hassleriana]
trEMBL	tr\|W9QTY5\|W9QTY5_9ROSA	1E-50	Uncharacterized protein {ECO:0000313\|EMBL:EXB38301.1}
TAIR10	AT2G41190.1	7E-42	Transmembrane amino acid transporter family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	39878376	39886743	+
GWHAAZE00000002	mRNA	39878376	39886743	+
GWHAAZE00000002	exon	39878376	39878529	+
GWHAAZE00000002	exon	39883007	39883050	+
GWHAAZE00000002	exon	39885338	39885400	+
GWHAAZE00000002	exon	39886651	39886743	+
GWHAAZE00000002	CDS	39878376	39878529	+
GWHAAZE00000002	CDS	39883007	39883050	+
GWHAAZE00000002	CDS	39885338	39885400	+
GWHAAZE00000002	CDS	39886651	39886743	+

Transcript Sequence
>GWHTAAZE007190 ATGCACAAATATGCTCTGTTGATGAACCCATTGGCTAGAAGTATAGAAGAGCTGCTCCCCATCAGAATTGCTAGTAGTAACTGGTGTTTTATGCTTCTCAGGACAGCTCTAGTTATCTCTTCTGTTGCTGTTGCATTTCTTCTTCCTTTCTTTGGTCTTGTAATGGCTTTAATTGGCTCTCTCCTTAGTATCCTCGTGGCAATTATAATGCCAGCTTTATGTTTCCTGAAAATTAAGGGGAAGAATGCAACAAAAACGCAGATTGTTTTGAGTACTGCTATCGTTGTATTGGGTGTCGCGAGTGCAGTGCTCGGAACTTACTCTTCACTGTCAGCAATTGCAGATAAGTACTGA

Network for GWHGAAZE007182

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01490.19	Aa_trans	3	109	1.90E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15015	SLC32A, VGAT	GABAergic synapse	map04727
		Retrograde endocannabinoid signaling	map04723
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.390
	SRR3591706	second leaf	2.208
	SRR3591707	mature leaf	13.692
	SRR3591708	Shoot apex	0.268
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	37.821
	SRR3591711	White flower	20.460
	SRR3591712	Green floral bud	56.121
	SRR3591713	Yellow flower	18.682
SRP173429	SRR8316895	Juvenile bud stage	9.144
	SRR8316896	Juvenile bud stage	10.278
	SRR8316897	Juvenile bud stage	9.517
	SRR8316894	Third green stage	9.201
	SRR8316900	Third green stage	38.687
	SRR8316901	Third green stage	31.356
	SRR8316898	Complete white stage	16.983
	SRR8316899	Complete white stage	22.751
	SRR8316903	Complete white stage	26.916
	SRR8316902	Silver flowering stage	27.531
	SRR8316904	Silver flowering stage	43.695
	SRR8316905	Silver flowering stage	23.942
	SRR8316906	Gold flowering stage	57.280
	SRR8316907	Gold flowering stage	59.254
	SRR8316908	Gold flowering stage	52.498
SRP132670	SRR6706286	Control	14.347
	SRR6706287	Light intensity 50%	14.317
	SRR6706288	Light intensity 20%	11.497
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.787
	CNS0095593	Slightly white alabastrum(diploid) 2	35.509
	CNS0095594	Slightly white alabastrum(diploid) 3	20.386
	CNS0095595	Whole white alabastrum(diploid) 2	69.552
	CNS0095596	Whole white alabastrum(diploid) 3	92.192
	CNS0095597	Whole white alabastrum(diploid) 4	97.340
	CNS0095598	Silvery flower (diploied) 1	44.727
	CNS0095599	Silvery flower (diploied) 2	57.768
	CNS0095600	Silvery flower (diploied) 3	68.624
	CNS0095601	Golden flower (diploid) 1	57.772
	CNS0095602	Golden flower (diploid) 2	58.307
	CNS0095603	Golden flower (diploid) 3	50.831
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.407
	CNS0095605	Slightly white alabastrum(tetraploid) 2	52.989
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.370
	CNS0095607	Whole white alabastrum(tetraploid) 1	90.711
	CNS0095608	Whole white alabastrum(tetraploid) 2	123.134
	CNS0095609	Whole white alabastrum(tetraploid) 3	56.371
	CNS0095610	Silvery flower (tetraploid) 1	84.489
	CNS0095611	Silvery flower (tetraploid) 2	90.650
	CNS0095612	Silvery flower (tetraploid) 3	78.961
	CNS0095613	Golden flower (tetraploid) 1	78.867
	CNS0095614	Golden flower (tetraploid) 2	64.642
	CNS0095615	Golden flower (tetraploid) 3	49.559
CRA001975	CRR073297	Stem 1	2.435
	CRR073298	Stem 2	2.546
	CRR073299	Stem 3	1.884
	CRR073300	Leaf 1	6.721
	CRR073301	Leaf 2	5.257
	CRR073302	Leaf 3	1.368
	CRR073303	Juvenile bud 1	2.650
	CRR073304	Juvenile bud 2	4.087
	CRR073305	Juvenile bud 3	4.361
	CRR073306	Third green 1	4.325
	CRR073307	Third green 2	7.822
	CRR073308	Third green 3	3.825
	CRR073309	Second white 1	7.852
	CRR073310	Second white 2	12.165
	CRR073311	Second white 3	10.555
	CRR073312	Silver flowering 1	12.299
	CRR073313	Silver flowering 2	3.585
	CRR073314	Silver flowering 3	6.052
	CRR073315	Gold flowering 1	3.055
	CRR073316	Gold flowering 2	11.989
	CRR073317	Gold flowering 3	3.036
	CRR073318	Tawny withering 1	3.541
	CRR073319	Tawny withering 2	4.013
	CRR073320	Tawny withering 3	3.357