Gene detail

Detail information of GWHGAAZE007184

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006351371.1	1.76338E-56	PREDICTED: TGACG-sequence-specific DNA-binding protein TGA-2.1-like [Solanum tuberosum]
Swissprot	tr\|O24160\|TGA21_TOBAC	5E-47	TGACG-sequence-specific DNA-binding protein TGA-2.1
trEMBL	tr\|M1C6P4\|M1C6P4_SOLTU	4E-57	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400060926}
TAIR10	AT5G06960.2	0.000000002	OCS-element binding factor 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	39918902	39920151	+
GWHAAZE00000002	mRNA	39918902	39920151	+
GWHAAZE00000002	exon	39918902	39919016	+
GWHAAZE00000002	exon	39919188	39919261	+
GWHAAZE00000002	exon	39919349	39919537	+
GWHAAZE00000002	exon	39919879	39919956	+
GWHAAZE00000002	exon	39920044	39920151	+
GWHAAZE00000002	CDS	39918902	39919016	+
GWHAAZE00000002	CDS	39919188	39919261	+
GWHAAZE00000002	CDS	39919349	39919537	+
GWHAAZE00000002	CDS	39919879	39919956	+
GWHAAZE00000002	CDS	39920044	39920151	+

Transcript Sequence
>GWHTAAZE007192 TTTGGCTTTAGTGGCACAGATGGGAACTCTACCTATCCTTCTCAAGTTTCCGATTTTGGGGCACTTGAGCAATCTCTTGGATTTCGAGTAGGGGATGCTGCTAATCTCGGTAGAAATCCTACACTCAACACGACAAATTTTGGTAGCCCATCAGTTGGCCCCGATCTCCAATTTGGGATGTTTGACAAGTCCATTGCCACAAATACAAATCTGTATGCTGCTATTTTGGAGTCTCAGACCTCACAATTACAAAAAGGTCCACAGCCAAATCTAGTTCCGGGTGGTCATCCTGAGAACTGGTGTGAATCCAATATGGCAGATACTAGTCCTCGGACTGATACTTCGACAGACATGGAGATAAATGACAACAATCAGAGGTTCGAAACAGACCAATCTATTGCTGTTGCAGCATCTGATTCTAGTGACAAATCAAAAGAAAAGTCTTTGGACCAAAAGGCACTACGGAGGCTTGCTCAAAATCGCGAAGCTGCCAGAAAGAGCCGGCTGAGAAAAAAAGTGGATTCCCTTGCATTTCAGTTTTTGTGCTTTTATTTCAGTTGCTGA

Network for GWHGAAZE007184

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07716.16	bZIP_2	150	174	8.80E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14431	TGA	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.681
	SRR3591706	second leaf	9.484
	SRR3591707	mature leaf	17.129
	SRR3591708	Shoot apex	13.650
	SRR3591709	Stem	18.018
	SRR3591710	White floral bud	10.487
	SRR3591711	White flower	16.259
	SRR3591712	Green floral bud	9.953
	SRR3591713	Yellow flower	12.841
SRP173429	SRR8316895	Juvenile bud stage	4.776
	SRR8316896	Juvenile bud stage	7.405
	SRR8316897	Juvenile bud stage	3.428
	SRR8316894	Third green stage	3.234
	SRR8316900	Third green stage	9.822
	SRR8316901	Third green stage	9.184
	SRR8316898	Complete white stage	2.630
	SRR8316899	Complete white stage	27.086
	SRR8316903	Complete white stage	7.864
	SRR8316902	Silver flowering stage	3.270
	SRR8316904	Silver flowering stage	3.824
	SRR8316905	Silver flowering stage	1.261
	SRR8316906	Gold flowering stage	7.301
	SRR8316907	Gold flowering stage	11.859
	SRR8316908	Gold flowering stage	7.666
SRP132670	SRR6706286	Control	13.646
	SRR6706287	Light intensity 50%	12.898
	SRR6706288	Light intensity 20%	13.419
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.464
	CNS0095593	Slightly white alabastrum(diploid) 2	2.282
	CNS0095594	Slightly white alabastrum(diploid) 3	3.541
	CNS0095595	Whole white alabastrum(diploid) 2	3.547
	CNS0095596	Whole white alabastrum(diploid) 3	1.753
	CNS0095597	Whole white alabastrum(diploid) 4	2.958
	CNS0095598	Silvery flower (diploied) 1	11.425
	CNS0095599	Silvery flower (diploied) 2	12.186
	CNS0095600	Silvery flower (diploied) 3	9.874
	CNS0095601	Golden flower (diploid) 1	8.704
	CNS0095602	Golden flower (diploid) 2	12.405
	CNS0095603	Golden flower (diploid) 3	11.065
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.786
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.162
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.545
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.821
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.139
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.458
	CNS0095610	Silvery flower (tetraploid) 1	11.199
	CNS0095611	Silvery flower (tetraploid) 2	9.710
	CNS0095612	Silvery flower (tetraploid) 3	8.620
	CNS0095613	Golden flower (tetraploid) 1	4.907
	CNS0095614	Golden flower (tetraploid) 2	14.622
	CNS0095615	Golden flower (tetraploid) 3	7.164
CRA001975	CRR073297	Stem 1	8.896
	CRR073298	Stem 2	7.036
	CRR073299	Stem 3	6.265
	CRR073300	Leaf 1	13.863
	CRR073301	Leaf 2	11.667
	CRR073302	Leaf 3	11.003
	CRR073303	Juvenile bud 1	8.725
	CRR073304	Juvenile bud 2	8.022
	CRR073305	Juvenile bud 3	15.527
	CRR073306	Third green 1	2.785
	CRR073307	Third green 2	2.442
	CRR073308	Third green 3	4.221
	CRR073309	Second white 1	4.970
	CRR073310	Second white 2	4.205
	CRR073311	Second white 3	7.692
	CRR073312	Silver flowering 1	5.970
	CRR073313	Silver flowering 2	1.907
	CRR073314	Silver flowering 3	5.905
	CRR073315	Gold flowering 1	12.383
	CRR073316	Gold flowering 2	15.114
	CRR073317	Gold flowering 3	11.319
	CRR073318	Tawny withering 1	18.334
	CRR073319	Tawny withering 2	28.022
	CRR073320	Tawny withering 3	18.195