Gene detail

Detail information of GWHGAAZE007295

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAM12501.1AF330161_1	2.87903E-72	phosphocholine cytidylyltransferase [Rosa hybrid cultivar]
Swissprot	tr\|F4JJE0\|CCT2_ARATH	2E-71	Choline-phosphate cytidylyltransferase 2
trEMBL	tr\|Q8S554\|Q8S554_ROSHC	1E-72	Phosphocholine cytidylyltransferase {ECO:0000313\|EMBL:AAM12501.1} (Fragment)
TAIR10	AT4G15130.1	4E-58	phosphorylcholine cytidylyltransferase2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	42263793	42264970	+
GWHAAZE00000002	mRNA	42263793	42264970	+
GWHAAZE00000002	exon	42263793	42263833	+
GWHAAZE00000002	exon	42263979	42264074	+
GWHAAZE00000002	exon	42264631	42264673	+
GWHAAZE00000002	exon	42264809	42264970	+
GWHAAZE00000002	CDS	42263793	42263833	+
GWHAAZE00000002	CDS	42263979	42264074	+
GWHAAZE00000002	CDS	42264631	42264673	+
GWHAAZE00000002	CDS	42264809	42264970	+

Transcript Sequence
>GWHTAAZE007303 ATGACAGAAGCAGAGCGATATGAATCCCTTCGACATTGCAAGTGGGTTGATGAAGTTATTCCGGACGCTCCATGGGTGCTCAGTCAGGAATTTATTGATAAGCATAACATTGACTACGTCGCTCATGATTCTCTGCCTTATGCTGATGCAAGTGGAGCTGGAAATGATGTTTATGAATTTGTTAAATCAATTGGGAAGTTCAAAGAAACAAAGCGTACCGATGGAATTTCAACATCGGATATTATAATGAGAATTGTTAAAGATTATAACCAGTATGTGTTGCGTAACTTGGATCGTGGATATTCCAGAAAGGAGCTGGGTGTTAGCTATGTGAAGGCATGA

Network for GWHGAAZE007295

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01467.27	CTP_transf_like	2	83	1.50E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00968	PCYT1	Metabolic pathways	map01100
		Glycerophospholipid metabolism	map00564
		Phosphonate and phosphinate metabolism	map00440

Gene Ontology

GO term	Ontology	Name
GO:0009058	biological_process	biosynthetic process
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.902
	SRR3591706	second leaf	12.815
	SRR3591707	mature leaf	34.790
	SRR3591708	Shoot apex	2.113
	SRR3591709	Stem	5.131
	SRR3591710	White floral bud	68.338
	SRR3591711	White flower	7.654
	SRR3591712	Green floral bud	153.138
	SRR3591713	Yellow flower	5.144
SRP173429	SRR8316895	Juvenile bud stage	3.534
	SRR8316896	Juvenile bud stage	19.090
	SRR8316897	Juvenile bud stage	6.503
	SRR8316894	Third green stage	9.361
	SRR8316900	Third green stage	76.791
	SRR8316901	Third green stage	60.292
	SRR8316898	Complete white stage	3.400
	SRR8316899	Complete white stage	14.708
	SRR8316903	Complete white stage	4.251
	SRR8316902	Silver flowering stage	1.501
	SRR8316904	Silver flowering stage	3.131
	SRR8316905	Silver flowering stage	1.931
	SRR8316906	Gold flowering stage	2.871
	SRR8316907	Gold flowering stage	1.699
	SRR8316908	Gold flowering stage	1.557
SRP132670	SRR6706286	Control	16.059
	SRR6706287	Light intensity 50%	15.141
	SRR6706288	Light intensity 20%	18.727
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.203
	CNS0095593	Slightly white alabastrum(diploid) 2	27.955
	CNS0095594	Slightly white alabastrum(diploid) 3	31.732
	CNS0095595	Whole white alabastrum(diploid) 2	140.810
	CNS0095596	Whole white alabastrum(diploid) 3	155.675
	CNS0095597	Whole white alabastrum(diploid) 4	235.958
	CNS0095598	Silvery flower (diploied) 1	3.662
	CNS0095599	Silvery flower (diploied) 2	12.255
	CNS0095600	Silvery flower (diploied) 3	10.029
	CNS0095601	Golden flower (diploid) 1	5.391
	CNS0095602	Golden flower (diploid) 2	6.460
	CNS0095603	Golden flower (diploid) 3	4.144
	CNS0095604	Slightly white alabastrum(tetraploid) 1	79.588
	CNS0095605	Slightly white alabastrum(tetraploid) 2	97.328
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.513
	CNS0095607	Whole white alabastrum(tetraploid) 1	243.709
	CNS0095608	Whole white alabastrum(tetraploid) 2	333.951
	CNS0095609	Whole white alabastrum(tetraploid) 3	111.105
	CNS0095610	Silvery flower (tetraploid) 1	6.774
	CNS0095611	Silvery flower (tetraploid) 2	12.618
	CNS0095612	Silvery flower (tetraploid) 3	16.252
	CNS0095613	Golden flower (tetraploid) 1	2.339
	CNS0095614	Golden flower (tetraploid) 2	8.657
	CNS0095615	Golden flower (tetraploid) 3	6.382
CRA001975	CRR073297	Stem 1	6.579
	CRR073298	Stem 2	5.953
	CRR073299	Stem 3	1.956
	CRR073300	Leaf 1	56.522
	CRR073301	Leaf 2	27.504
	CRR073302	Leaf 3	10.766
	CRR073303	Juvenile bud 1	54.255
	CRR073304	Juvenile bud 2	37.722
	CRR073305	Juvenile bud 3	0.778
	CRR073306	Third green 1	5.166
	CRR073307	Third green 2	8.478
	CRR073308	Third green 3	7.220
	CRR073309	Second white 1	1.051
	CRR073310	Second white 2	4.519
	CRR073311	Second white 3	2.725
	CRR073312	Silver flowering 1	13.291
	CRR073313	Silver flowering 2	8.389
	CRR073314	Silver flowering 3	5.335
	CRR073315	Gold flowering 1	23.276
	CRR073316	Gold flowering 2	18.545
	CRR073317	Gold flowering 3	10.776
	CRR073318	Tawny withering 1	18.524
	CRR073319	Tawny withering 2	10.765
	CRR073320	Tawny withering 3	15.882