Gene detail

Detail information of GWHGAAZE007330

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHY00342.1	2.96329E-60	MYB110 [Actinidia chinensis]
Swissprot	tr\|Q9FNV9\|MY113_ARATH	3E-56	Transcription factor MYB113
trEMBL	tr\|A0A075DWE2\|A0A075DWE2_ACTCH	1E-60	MYB110 {ECO:0000313\|EMBL:AHY00342.1}
TAIR10	AT1G66370.1	8E-46	myb domain protein 113

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	43266598	43267965	+
GWHAAZE00000002	mRNA	43266598	43267965	+
GWHAAZE00000002	exon	43266598	43266736	+
GWHAAZE00000002	exon	43267174	43267303	+
GWHAAZE00000002	exon	43267881	43267965	+
GWHAAZE00000002	CDS	43266598	43266736	+
GWHAAZE00000002	CDS	43267174	43267303	+
GWHAAZE00000002	CDS	43267881	43267965	+

Transcript Sequence
>GWHTAAZE007338 ATGGAGAGTAATGGTAAAGGTAGTAGTATAGATTTAGGAGTGAGAAAAGGTGCATGGACTACAGAGGAAGATTTTCTTCTCAAAAAGTGCATTGAAAAATATGGTGCAGGAAAGTGGCACCAAGTTCCTCTTAGAGCAGGGTTGAATAGATGCAGAAAGAGTTGTAGACTAAGGTGGCTAAACTATCTTAGGCCAAACATTAAAAGAGGCTGTTTTACAGAAGATGAAGACGATCTCATCATGAGGCTTCATAATCTCTTAGGCAACAGATGGTCATTGATAGCTGGTAGATTGCCGGAAAGAACAGCTAATGATGTGAAGAATTACTGGAACACCCAACTACAAAAAAGACTT

Network for GWHGAAZE007330

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0263

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	16	63	3.10E-16
PF00249.32	Myb_DNA-binding	69	113	1.70E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.600
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.946
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.111
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.496
	SRR8316900	Third green stage	4.880
	SRR8316901	Third green stage	4.515
	SRR8316898	Complete white stage	0.358
	SRR8316899	Complete white stage	12.605
	SRR8316903	Complete white stage	2.148
	SRR8316902	Silver flowering stage	0.326
	SRR8316904	Silver flowering stage	0.097
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.586
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.793
	SRR6706287	Light intensity 50%	0.747
	SRR6706288	Light intensity 20%	0.528
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.406
	CNS0095593	Slightly white alabastrum(diploid) 2	0.064
	CNS0095594	Slightly white alabastrum(diploid) 3	0.451
	CNS0095595	Whole white alabastrum(diploid) 2	0.438
	CNS0095596	Whole white alabastrum(diploid) 3	0.699
	CNS0095597	Whole white alabastrum(diploid) 4	0.251
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.309
	CNS0095600	Silvery flower (diploied) 3	0.107
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.069
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.024
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.108
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.177
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.751
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.104
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.378
	CNS0095610	Silvery flower (tetraploid) 1	0.150
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.114
	CNS0095614	Golden flower (tetraploid) 2	0.162
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	1.909
	CRR073301	Leaf 2	0.551
	CRR073302	Leaf 3	0.951
	CRR073303	Juvenile bud 1	0.846
	CRR073304	Juvenile bud 2	0.928
	CRR073305	Juvenile bud 3	1.551
	CRR073306	Third green 1	0.372
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000