Gene detail

Detail information of GWHGAAZE007349

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007033119.1	8.59177E-64	RING/FYVE/PHD zinc finger superfamily protein [Theobroma cacao]
Swissprot	tr\|P06405\|PSAA_TOBAC	2E-14	Photosystem I P700 chlorophyll a apoprotein A1 {ECO:0000255\|HAMAP-Rule:MF_00458}
trEMBL	tr\|A0A061EGA0\|A0A061EGA0_THECC	3E-64	RING/FYVE/PHD zinc finger superfamily protein {ECO:0000313\|EMBL:EOY04045.1}
TAIR10	AT2G01275.2	1E-36	RING/FYVE/PHD zinc finger superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	43682013	43684365	+
GWHAAZE00000002	mRNA	43682013	43684365	+
GWHAAZE00000002	exon	43682013	43682237	+
GWHAAZE00000002	exon	43683053	43683124	+
GWHAAZE00000002	exon	43683287	43683354	+
GWHAAZE00000002	exon	43683627	43683769	+
GWHAAZE00000002	exon	43684163	43684365	+
GWHAAZE00000002	CDS	43682013	43682237	+
GWHAAZE00000002	CDS	43683053	43683124	+
GWHAAZE00000002	CDS	43683287	43683354	+
GWHAAZE00000002	CDS	43683627	43683769	+
GWHAAZE00000002	CDS	43684163	43684365	+

Transcript Sequence
>GWHTAAZE007357 ATGGGGGATCATTTTCTAAATACTGGCGACTGGTTTCTTTCTCAATCTACCCTCGAGATCGCTATTGAGAGTGAAAGCTACTCGCATCTTGCCTTGGAGGATTTTTCTTCAAAATGGACGGTGGATATTGCATCGCCAAGAGAATTGGTAGAGTGCAAGATTTGCCACGATGAGGATGAAGACTTGAAAATGGAGATGCCATGTTCGTGCCGTGGCAGCTTAAAGTATGCACACCGTGCGTGTATCCAAAGGTGGTGCAATGAGAAGGGCAACACTGTATGTGAGATTTGCCAGCAGCAATTCAAGCCAGGTTATACAGCACCACCTCCTACAGTTCATTATGATGGTATTTTTATGGACTTAAGCAATTATCTGAGGGGAAACTGGGAGATTCGAAGGGACCTGCATGATCATGAATTTTTAGCAATGGATTCTACTGATCACAATTTTTCAGATGGTGACATTGATGAATATCCAACCTCCTCTTCAAGAAGCCTAATATATTGCCGTATACAATTTCACTTCCCACCTGTGACGTTCCCAAAAAGCCTTTGGGTTAAGGGAGAAGTCCGTCTTTTCAAAATTCTCGGTGGACTTAGGGCGGCCCAAGATATGTTTTCAGATACCGCTATTCAATTACAACCCGTCTTTGCTCAATGGATACAAAACACCTATGCTTTAGCACCCGGTGCATCGGCTCCTGGTACATGA

Network for GWHGAAZE007349

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12906.8	RINGv	52	97	2.40E-13
PF12428.9	DUF3675	103	171	1.30E-12
PF00223.20	PsaA_PsaB	200	225	4.90E-06

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009522	cellular_component	photosystem I
GO:0009579	cellular_component	thylakoid
GO:0016021	cellular_component	integral component of membrane
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.257
	SRR3591706	second leaf	11.837
	SRR3591707	mature leaf	17.238
	SRR3591708	Shoot apex	15.215
	SRR3591709	Stem	18.026
	SRR3591710	White floral bud	12.754
	SRR3591711	White flower	18.346
	SRR3591712	Green floral bud	12.636
	SRR3591713	Yellow flower	10.424
SRP173429	SRR8316895	Juvenile bud stage	22.321
	SRR8316896	Juvenile bud stage	30.184
	SRR8316897	Juvenile bud stage	11.212
	SRR8316894	Third green stage	10.049
	SRR8316900	Third green stage	17.128
	SRR8316901	Third green stage	18.926
	SRR8316898	Complete white stage	7.155
	SRR8316899	Complete white stage	26.739
	SRR8316903	Complete white stage	13.311
	SRR8316902	Silver flowering stage	12.790
	SRR8316904	Silver flowering stage	13.981
	SRR8316905	Silver flowering stage	6.841
	SRR8316906	Gold flowering stage	24.977
	SRR8316907	Gold flowering stage	25.752
	SRR8316908	Gold flowering stage	18.223
SRP132670	SRR6706286	Control	19.305
	SRR6706287	Light intensity 50%	17.603
	SRR6706288	Light intensity 20%	19.484
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.035
	CNS0095593	Slightly white alabastrum(diploid) 2	22.291
	CNS0095594	Slightly white alabastrum(diploid) 3	25.660
	CNS0095595	Whole white alabastrum(diploid) 2	15.493
	CNS0095596	Whole white alabastrum(diploid) 3	13.437
	CNS0095597	Whole white alabastrum(diploid) 4	16.887
	CNS0095598	Silvery flower (diploied) 1	34.613
	CNS0095599	Silvery flower (diploied) 2	22.922
	CNS0095600	Silvery flower (diploied) 3	12.988
	CNS0095601	Golden flower (diploid) 1	33.328
	CNS0095602	Golden flower (diploid) 2	18.587
	CNS0095603	Golden flower (diploid) 3	16.805
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.561
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.445
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.837
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.315
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.733
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.674
	CNS0095610	Silvery flower (tetraploid) 1	11.128
	CNS0095611	Silvery flower (tetraploid) 2	10.700
	CNS0095612	Silvery flower (tetraploid) 3	4.651
	CNS0095613	Golden flower (tetraploid) 1	6.444
	CNS0095614	Golden flower (tetraploid) 2	9.351
	CNS0095615	Golden flower (tetraploid) 3	3.655
CRA001975	CRR073297	Stem 1	18.389
	CRR073298	Stem 2	14.397
	CRR073299	Stem 3	7.608
	CRR073300	Leaf 1	16.717
	CRR073301	Leaf 2	18.131
	CRR073302	Leaf 3	9.534
	CRR073303	Juvenile bud 1	4.743
	CRR073304	Juvenile bud 2	3.245
	CRR073305	Juvenile bud 3	5.260
	CRR073306	Third green 1	1.773
	CRR073307	Third green 2	1.617
	CRR073308	Third green 3	1.765
	CRR073309	Second white 1	0.975
	CRR073310	Second white 2	1.183
	CRR073311	Second white 3	0.399
	CRR073312	Silver flowering 1	1.577
	CRR073313	Silver flowering 2	0.616
	CRR073314	Silver flowering 3	1.294
	CRR073315	Gold flowering 1	7.309
	CRR073316	Gold flowering 2	9.539
	CRR073317	Gold flowering 3	7.264
	CRR073318	Tawny withering 1	17.894
	CRR073319	Tawny withering 2	14.893
	CRR073320	Tawny withering 3	9.835