Gene detail

Detail information of GWHGAAZE007413

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP02810.1	2.84586E-95	unnamed protein product [Coffea canephora]
Swissprot	tr\|O23208\|ATB40_ARATH	7E-72	Homeobox-leucine zipper protein ATHB-40
trEMBL	tr\|A0A068U2N9\|A0A068U2N9_COFCA	1E-95	Coffea canephora DH200=94 genomic scaffold, scaffold_8 {ECO:0000313\|EMBL:CDP02810.1}
TAIR10	AT4G36740.1	4E-58	homeobox protein 40

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	44847021	44849146	+
GWHAAZE00000002	mRNA	44847021	44849146	+
GWHAAZE00000002	exon	44847021	44847114	+
GWHAAZE00000002	exon	44847448	44847728	+
GWHAAZE00000002	exon	44848925	44849146	+
GWHAAZE00000002	CDS	44847021	44847114	+
GWHAAZE00000002	CDS	44847448	44847728	+
GWHAAZE00000002	CDS	44848925	44849146	+

Transcript Sequence
>GWHTAAZE007421 ATGGCAACCAGCATGAATAATCTGGTTGATGATCAAATGGTGCTTCTCTCACAGTACTATCCTGGGATATACACTCAGCTGGAACCAGAGAAAGGAGAAGTGAAGCCGAGGCGGAGGCGAAAGAAGAACAAAGGGGAGGCAAGCAGTAGTAGCGGATTTAGGAAGAGGAAGCTAACTGATGAACAAGTTAATCTCCTTGAGATAAATTTTGGTAATGAGCACAAATTGGAGTCAGAGAGAAAGGATAAGCTGGCTGCTGAACTGGGGCTTGACCCTCGCCAAGTGGCGGTCTGGTTCCAGAACAGGCGGGCTCGATGGAAGACCAAGAAGCTTGAGGAGGAATACTCTAAGTTGAAGAATGAACATGAGAGCAGTGTATTTAAGCTCAAGGAACAACTATCCGAAGCGGAGAAGGAGATACAAAGGCTATTGGAGCGCGTTGATGGGGTTTCAATCAACAGCCCGTGTTCATCGTTCTCAATGGAGGCTATGGACCCGCCTTTTCTTGGGGAATTTGGGATGGAAGGATTGGAAAATGTTTTTTACGTGCCCGAAAACAATTATATTCACGGATTGGAGTGGGTTAATCTAATGTGA

Network for GWHGAAZE007413

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	56	107	9.40E-17

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-other

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.421
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	5.773
	SRR3591709	Stem	1.023
	SRR3591710	White floral bud	4.752
	SRR3591711	White flower	106.804
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	104.405
SRP173429	SRR8316895	Juvenile bud stage	0.312
	SRR8316896	Juvenile bud stage	0.360
	SRR8316897	Juvenile bud stage	0.045
	SRR8316894	Third green stage	0.302
	SRR8316900	Third green stage	0.160
	SRR8316901	Third green stage	0.112
	SRR8316898	Complete white stage	0.697
	SRR8316899	Complete white stage	2.336
	SRR8316903	Complete white stage	2.124
	SRR8316902	Silver flowering stage	17.503
	SRR8316904	Silver flowering stage	19.053
	SRR8316905	Silver flowering stage	0.449
	SRR8316906	Gold flowering stage	3.847
	SRR8316907	Gold flowering stage	26.248
	SRR8316908	Gold flowering stage	15.277
SRP132670	SRR6706286	Control	1.599
	SRR6706287	Light intensity 50%	0.502
	SRR6706288	Light intensity 20%	0.287
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.905
	CNS0095593	Slightly white alabastrum(diploid) 2	0.639
	CNS0095594	Slightly white alabastrum(diploid) 3	2.127
	CNS0095595	Whole white alabastrum(diploid) 2	0.507
	CNS0095596	Whole white alabastrum(diploid) 3	0.070
	CNS0095597	Whole white alabastrum(diploid) 4	0.709
	CNS0095598	Silvery flower (diploied) 1	11.973
	CNS0095599	Silvery flower (diploied) 2	2.026
	CNS0095600	Silvery flower (diploied) 3	30.135
	CNS0095601	Golden flower (diploid) 1	8.587
	CNS0095602	Golden flower (diploid) 2	19.387
	CNS0095603	Golden flower (diploid) 3	18.550
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.066
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.500
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.074
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.248
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.288
	CNS0095610	Silvery flower (tetraploid) 1	177.954
	CNS0095611	Silvery flower (tetraploid) 2	58.895
	CNS0095612	Silvery flower (tetraploid) 3	5.187
	CNS0095613	Golden flower (tetraploid) 1	54.656
	CNS0095614	Golden flower (tetraploid) 2	55.417
	CNS0095615	Golden flower (tetraploid) 3	70.833
CRA001975	CRR073297	Stem 1	3.486
	CRR073298	Stem 2	1.473
	CRR073299	Stem 3	1.876
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.016
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.107
	CRR073306	Third green 1	0.617
	CRR073307	Third green 2	2.006
	CRR073308	Third green 3	6.459
	CRR073309	Second white 1	2.010
	CRR073310	Second white 2	2.359
	CRR073311	Second white 3	1.916
	CRR073312	Silver flowering 1	7.239
	CRR073313	Silver flowering 2	4.876
	CRR073314	Silver flowering 3	5.780
	CRR073315	Gold flowering 1	1.081
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.285
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.648
	CRR073320	Tawny withering 3	0.000