Gene detail

Detail information of GWHGAAZE007434

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007046943.1	9.68882E-41	Clathrin adaptor complex small chain family protein [Theobroma cacao]
Swissprot	tr\|Q8VZ37\|AP3S_ARATH	1E-39	AP-3 complex subunit sigma
trEMBL	tr\|A0A061DFS8\|A0A061DFS8_THECC	4E-41	Clathrin adaptor complex small chain family protein {ECO:0000313\|EMBL:EOX91100.1}
TAIR10	AT3G50860.1	7E-32	Clathrin adaptor complex small chain family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	45294298	45295834	-
GWHAAZE00000002	mRNA	45294298	45295834	-
GWHAAZE00000002	exon	45295751	45295834	-
GWHAAZE00000002	exon	45295294	45295390	-
GWHAAZE00000002	exon	45294298	45294368	-
GWHAAZE00000002	CDS	45295751	45295834	-
GWHAAZE00000002	CDS	45295294	45295390	-
GWHAAZE00000002	CDS	45294298	45294368	-

Transcript Sequence
>GWHTAAZE007442 ATGGTAGTTTCGATTATCCAAGTATTATGCAGCAGACCTGAAAATGTTAGCAATTTCATTGAGGGCGAATCAATCTTCGGTCCGGGTATCAATCTTGTGTACAAACACTTTGCAACCTTATACTTTGTATTTGTATTTGGTAGATCAGAAAATGAGTTGGCTATGCTCGATCTGATACAAGTTTTTGTGCAGACGTTGGAGAAATGCTTCAAAAATGTATGCGAGCTAGATATAGTACTGAATTATAGCAAG

Network for GWHGAAZE007434

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01217.21	Clat_adaptor_s	2	84	7.60E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12399	AP3S	Lysosome	map04142

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0016192	biological_process	vesicle-mediated transport
GO:0030117	cellular_component	membrane coat

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.614
	SRR3591706	second leaf	2.787
	SRR3591707	mature leaf	2.658
	SRR3591708	Shoot apex	1.633
	SRR3591709	Stem	5.601
	SRR3591710	White floral bud	6.574
	SRR3591711	White flower	6.405
	SRR3591712	Green floral bud	9.686
	SRR3591713	Yellow flower	4.408
SRP173429	SRR8316895	Juvenile bud stage	0.648
	SRR8316896	Juvenile bud stage	1.364
	SRR8316897	Juvenile bud stage	0.366
	SRR8316894	Third green stage	1.839
	SRR8316900	Third green stage	6.283
	SRR8316901	Third green stage	6.431
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	2.679
	SRR8316903	Complete white stage	0.695
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.389
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.192
SRP132670	SRR6706286	Control	0.692
	SRR6706287	Light intensity 50%	0.687
	SRR6706288	Light intensity 20%	0.842
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.650
	CNS0095593	Slightly white alabastrum(diploid) 2	1.467
	CNS0095594	Slightly white alabastrum(diploid) 3	8.254
	CNS0095595	Whole white alabastrum(diploid) 2	4.815
	CNS0095596	Whole white alabastrum(diploid) 3	6.553
	CNS0095597	Whole white alabastrum(diploid) 4	2.894
	CNS0095598	Silvery flower (diploied) 1	3.390
	CNS0095599	Silvery flower (diploied) 2	2.838
	CNS0095600	Silvery flower (diploied) 3	1.048
	CNS0095601	Golden flower (diploid) 1	4.779
	CNS0095602	Golden flower (diploid) 2	3.094
	CNS0095603	Golden flower (diploid) 3	3.084
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.919
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.920
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.937
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.305
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.527
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.799
	CNS0095610	Silvery flower (tetraploid) 1	0.748
	CNS0095611	Silvery flower (tetraploid) 2	0.596
	CNS0095612	Silvery flower (tetraploid) 3	0.811
	CNS0095613	Golden flower (tetraploid) 1	0.244
	CNS0095614	Golden flower (tetraploid) 2	0.416
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.476
	CRR073298	Stem 2	0.759
	CRR073299	Stem 3	0.335
	CRR073300	Leaf 1	0.451
	CRR073301	Leaf 2	0.352
	CRR073302	Leaf 3	0.173
	CRR073303	Juvenile bud 1	0.071
	CRR073304	Juvenile bud 2	0.094
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.868
	CRR073311	Second white 3	0.253
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.011
	CRR073316	Gold flowering 2	1.413
	CRR073317	Gold flowering 3	1.208
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000