Gene detail

Detail information of GWHGAAZE007455

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP01996.1	6.81038E-81	unnamed protein product [Coffea canephora]
Swissprot	tr\|O48556\|IPYR_MAIZE	7E-74	Soluble inorganic pyrophosphatase
trEMBL	tr\|A0A068U0F6\|A0A068U0F6_COFCA	3E-81	Coffea canephora DH200=94 genomic scaffold, scaffold_7 {ECO:0000313\|EMBL:CDP01996.1}
TAIR10	AT1G01050.1	2E-58	pyrophosphorylase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	45565591	45567786	+
GWHAAZE00000002	mRNA	45565591	45567786	+
GWHAAZE00000002	exon	45565591	45565723	+
GWHAAZE00000002	exon	45566119	45566147	+
GWHAAZE00000002	exon	45566757	45566822	+
GWHAAZE00000002	exon	45567035	45567142	+
GWHAAZE00000002	exon	45567256	45567321	+
GWHAAZE00000002	exon	45567700	45567786	+
GWHAAZE00000002	five_prime_UTR	45565591	45565596	+
GWHAAZE00000002	CDS	45565597	45565723	+
GWHAAZE00000002	CDS	45566119	45566147	+
GWHAAZE00000002	CDS	45566757	45566822	+
GWHAAZE00000002	CDS	45567035	45567142	+
GWHAAZE00000002	CDS	45567256	45567321	+
GWHAAZE00000002	CDS	45567700	45567786	+

Transcript Sequence
>GWHTAAZE007463 GTGAAAATGGCTAACAGTGGGCAAAGGAGTGAAAAACATTCTGGAAATTCCCACGTAGTTCTCAATGAAAGGATCCTCTCCTCGATGTCACGAAGATCTATTGCCGCTCACCCCTGGCATGACTTAGAAATTGGTCCAGGTGCACCTGCGGTTTTCAACACTGTGGTTGAAATTGGAAAAGGTAGTAAAGTCAAGTATGAGCTTGACAAGGCAAGTGGGCTAATCAAAGTTGATCGAATCCTTTATTCATCAGTGGTTTATCCACACAACTATGGCTTCATACCACGCACGCTTTGTGAAGATAGTGATCCAATGGATGTCCTTGTACTGATGCAGGAACCTGTATTGCCAGGCACCTTCCTACGTGCTCGAGCTATTGGATTGATGCCTATGATTGATCAGGCAAGAGATCTTCTTCCTCGCTTGATCTCTCATGATCAAGATCAGAAGGAAACCTGGATATGCAATTCTCAATTGCAGAGCTCTTGA

Network for GWHGAAZE007455

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00719.20	Pyrophosphatase	53	133	1.10E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01507	ppa	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0006796	biological_process	phosphate-containing compound metabolic process
GO:0005737	cellular_component	cytoplasm
GO:0000287	molecular_function	magnesium ion binding
GO:0004427	molecular_function	inorganic diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.413
	SRR3591706	second leaf	45.809
	SRR3591707	mature leaf	54.830
	SRR3591708	Shoot apex	41.960
	SRR3591709	Stem	36.096
	SRR3591710	White floral bud	44.302
	SRR3591711	White flower	42.864
	SRR3591712	Green floral bud	43.972
	SRR3591713	Yellow flower	41.060
SRP173429	SRR8316895	Juvenile bud stage	25.004
	SRR8316896	Juvenile bud stage	35.870
	SRR8316897	Juvenile bud stage	18.920
	SRR8316894	Third green stage	16.409
	SRR8316900	Third green stage	63.411
	SRR8316901	Third green stage	57.706
	SRR8316898	Complete white stage	29.821
	SRR8316899	Complete white stage	67.015
	SRR8316903	Complete white stage	39.884
	SRR8316902	Silver flowering stage	26.999
	SRR8316904	Silver flowering stage	33.294
	SRR8316905	Silver flowering stage	12.203
	SRR8316906	Gold flowering stage	48.129
	SRR8316907	Gold flowering stage	52.744
	SRR8316908	Gold flowering stage	56.116
SRP132670	SRR6706286	Control	105.579
	SRR6706287	Light intensity 50%	108.607
	SRR6706288	Light intensity 20%	122.403
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.214
	CNS0095593	Slightly white alabastrum(diploid) 2	36.753
	CNS0095594	Slightly white alabastrum(diploid) 3	30.162
	CNS0095595	Whole white alabastrum(diploid) 2	38.469
	CNS0095596	Whole white alabastrum(diploid) 3	42.966
	CNS0095597	Whole white alabastrum(diploid) 4	42.337
	CNS0095598	Silvery flower (diploied) 1	41.544
	CNS0095599	Silvery flower (diploied) 2	47.708
	CNS0095600	Silvery flower (diploied) 3	55.095
	CNS0095601	Golden flower (diploid) 1	36.294
	CNS0095602	Golden flower (diploid) 2	41.927
	CNS0095603	Golden flower (diploid) 3	41.984
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.861
	CNS0095605	Slightly white alabastrum(tetraploid) 2	32.523
	CNS0095606	Slightly white alabastrum(tetraploid) 3	41.959
	CNS0095607	Whole white alabastrum(tetraploid) 1	26.459
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.551
	CNS0095609	Whole white alabastrum(tetraploid) 3	51.391
	CNS0095610	Silvery flower (tetraploid) 1	69.275
	CNS0095611	Silvery flower (tetraploid) 2	63.002
	CNS0095612	Silvery flower (tetraploid) 3	59.752
	CNS0095613	Golden flower (tetraploid) 1	38.342
	CNS0095614	Golden flower (tetraploid) 2	50.432
	CNS0095615	Golden flower (tetraploid) 3	30.945
CRA001975	CRR073297	Stem 1	46.437
	CRR073298	Stem 2	47.658
	CRR073299	Stem 3	60.685
	CRR073300	Leaf 1	71.887
	CRR073301	Leaf 2	78.791
	CRR073302	Leaf 3	88.698
	CRR073303	Juvenile bud 1	100.817
	CRR073304	Juvenile bud 2	105.241
	CRR073305	Juvenile bud 3	93.295
	CRR073306	Third green 1	42.103
	CRR073307	Third green 2	32.548
	CRR073308	Third green 3	39.724
	CRR073309	Second white 1	59.702
	CRR073310	Second white 2	31.205
	CRR073311	Second white 3	26.209
	CRR073312	Silver flowering 1	23.918
	CRR073313	Silver flowering 2	29.814
	CRR073314	Silver flowering 3	21.056
	CRR073315	Gold flowering 1	68.440
	CRR073316	Gold flowering 2	74.759
	CRR073317	Gold flowering 3	66.987
	CRR073318	Tawny withering 1	51.093
	CRR073319	Tawny withering 2	49.059
	CRR073320	Tawny withering 3	46.454